ID: 1043875799

View in Genome Browser
Species Human (GRCh38)
Location 8:85484635-85484657
Sequence CTGTTCCACCTGGTCTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043875792_1043875799 20 Left 1043875792 8:85484592-85484614 CCTAGGCTAGCCCTGGCTCCATC No data
Right 1043875799 8:85484635-85484657 CTGTTCCACCTGGTCTTTGGAGG No data
1043875794_1043875799 9 Left 1043875794 8:85484603-85484625 CCTGGCTCCATCTGTGTCTGCTG No data
Right 1043875799 8:85484635-85484657 CTGTTCCACCTGGTCTTTGGAGG No data
1043875796_1043875799 2 Left 1043875796 8:85484610-85484632 CCATCTGTGTCTGCTGGTGTTCT No data
Right 1043875799 8:85484635-85484657 CTGTTCCACCTGGTCTTTGGAGG No data
1043875793_1043875799 10 Left 1043875793 8:85484602-85484624 CCCTGGCTCCATCTGTGTCTGCT No data
Right 1043875799 8:85484635-85484657 CTGTTCCACCTGGTCTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043875799 Original CRISPR CTGTTCCACCTGGTCTTTGG AGG Intergenic
No off target data available for this crispr