ID: 1043875802

View in Genome Browser
Species Human (GRCh38)
Location 8:85484651-85484673
Sequence TTGGAGGTACTAATAACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043875794_1043875802 25 Left 1043875794 8:85484603-85484625 CCTGGCTCCATCTGTGTCTGCTG No data
Right 1043875802 8:85484651-85484673 TTGGAGGTACTAATAACTGAAGG No data
1043875796_1043875802 18 Left 1043875796 8:85484610-85484632 CCATCTGTGTCTGCTGGTGTTCT No data
Right 1043875802 8:85484651-85484673 TTGGAGGTACTAATAACTGAAGG No data
1043875793_1043875802 26 Left 1043875793 8:85484602-85484624 CCCTGGCTCCATCTGTGTCTGCT No data
Right 1043875802 8:85484651-85484673 TTGGAGGTACTAATAACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043875802 Original CRISPR TTGGAGGTACTAATAACTGA AGG Intergenic
No off target data available for this crispr