ID: 1043885111

View in Genome Browser
Species Human (GRCh38)
Location 8:85590008-85590030
Sequence GCTCAAGTATGTGCATTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043885106_1043885111 8 Left 1043885106 8:85589977-85589999 CCTGATAAGATCTCAGGAGTTGG 0: 124
1: 276
2: 289
3: 244
4: 222
Right 1043885111 8:85590008-85590030 GCTCAAGTATGTGCATTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043885111 Original CRISPR GCTCAAGTATGTGCATTAAA AGG Intergenic
No off target data available for this crispr