ID: 1043888894

View in Genome Browser
Species Human (GRCh38)
Location 8:85634251-85634273
Sequence CTGTCTTAACAGATAAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043888893_1043888894 21 Left 1043888893 8:85634207-85634229 CCACTGAGAATGAGAGCTGTAAA No data
Right 1043888894 8:85634251-85634273 CTGTCTTAACAGATAAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043888894 Original CRISPR CTGTCTTAACAGATAAAACA AGG Intergenic
No off target data available for this crispr