ID: 1043889221

View in Genome Browser
Species Human (GRCh38)
Location 8:85637984-85638006
Sequence CTCTATCACCAGGAACTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043889217_1043889221 20 Left 1043889217 8:85637941-85637963 CCAGTTTGAGAGGGAAAGGTGCA No data
Right 1043889221 8:85637984-85638006 CTCTATCACCAGGAACTTCAAGG No data
1043889219_1043889221 -10 Left 1043889219 8:85637971-85637993 CCTTAGAGAAGAACTCTATCACC No data
Right 1043889221 8:85637984-85638006 CTCTATCACCAGGAACTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043889221 Original CRISPR CTCTATCACCAGGAACTTCA AGG Intergenic
No off target data available for this crispr