ID: 1043891963

View in Genome Browser
Species Human (GRCh38)
Location 8:85658561-85658583
Sequence ATGGAGAAAGGGCTTCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043891963_1043891967 -9 Left 1043891963 8:85658561-85658583 CCAGCCTGAAGCCCTTTCTCCAT No data
Right 1043891967 8:85658575-85658597 TTTCTCCATTTCAGCTATTTTGG No data
1043891963_1043891969 3 Left 1043891963 8:85658561-85658583 CCAGCCTGAAGCCCTTTCTCCAT No data
Right 1043891969 8:85658587-85658609 AGCTATTTTGGCAGTTGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043891963 Original CRISPR ATGGAGAAAGGGCTTCAGGC TGG (reversed) Intergenic
No off target data available for this crispr