ID: 1043894141

View in Genome Browser
Species Human (GRCh38)
Location 8:85724136-85724158
Sequence ATGGAGAAAGGGCTTCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043894135_1043894141 3 Left 1043894135 8:85724110-85724132 CCTAGGCAACTGCCAAAATAGCT No data
Right 1043894141 8:85724136-85724158 ATGGAGAAAGGGCTTCAGGCTGG No data
1043894137_1043894141 -9 Left 1043894137 8:85724122-85724144 CCAAAATAGCTGAAATGGAGAAA No data
Right 1043894141 8:85724136-85724158 ATGGAGAAAGGGCTTCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043894141 Original CRISPR ATGGAGAAAGGGCTTCAGGC TGG Intergenic
No off target data available for this crispr