ID: 1043894853

View in Genome Browser
Species Human (GRCh38)
Location 8:85730306-85730328
Sequence ATGGAGAAAGGGCTTCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043894849_1043894853 -9 Left 1043894849 8:85730292-85730314 CCAAAATAGCTGAAATGGAGAAA No data
Right 1043894853 8:85730306-85730328 ATGGAGAAAGGGCTTCAGGCTGG No data
1043894847_1043894853 3 Left 1043894847 8:85730280-85730302 CCTAGGCAACTGCCAAAATAGCT No data
Right 1043894853 8:85730306-85730328 ATGGAGAAAGGGCTTCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043894853 Original CRISPR ATGGAGAAAGGGCTTCAGGC TGG Intergenic
No off target data available for this crispr