ID: 1043903365

View in Genome Browser
Species Human (GRCh38)
Location 8:85794253-85794275
Sequence ATGGAGAAAGGGCTTCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043903365_1043903369 -9 Left 1043903365 8:85794253-85794275 CCAGCCTGAAGCCCTTTCTCCAT No data
Right 1043903369 8:85794267-85794289 TTTCTCCATTTCAGCTATTTTGG No data
1043903365_1043903371 3 Left 1043903365 8:85794253-85794275 CCAGCCTGAAGCCCTTTCTCCAT No data
Right 1043903371 8:85794279-85794301 AGCTATTTTGGCAGTTGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043903365 Original CRISPR ATGGAGAAAGGGCTTCAGGC TGG (reversed) Intergenic
No off target data available for this crispr