ID: 1043903365 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:85794253-85794275 |
| Sequence | ATGGAGAAAGGGCTTCAGGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1043903365_1043903369 | -9 | Left | 1043903365 | 8:85794253-85794275 | CCAGCCTGAAGCCCTTTCTCCAT | No data | ||
| Right | 1043903369 | 8:85794267-85794289 | TTTCTCCATTTCAGCTATTTTGG | No data | ||||
| 1043903365_1043903371 | 3 | Left | 1043903365 | 8:85794253-85794275 | CCAGCCTGAAGCCCTTTCTCCAT | No data | ||
| Right | 1043903371 | 8:85794279-85794301 | AGCTATTTTGGCAGTTGCCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1043903365 | Original CRISPR | ATGGAGAAAGGGCTTCAGGC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||