ID: 1043903369

View in Genome Browser
Species Human (GRCh38)
Location 8:85794267-85794289
Sequence TTTCTCCATTTCAGCTATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043903365_1043903369 -9 Left 1043903365 8:85794253-85794275 CCAGCCTGAAGCCCTTTCTCCAT No data
Right 1043903369 8:85794267-85794289 TTTCTCCATTTCAGCTATTTTGG No data
1043903364_1043903369 4 Left 1043903364 8:85794240-85794262 CCTCTGCTAGTCACCAGCCTGAA No data
Right 1043903369 8:85794267-85794289 TTTCTCCATTTCAGCTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043903369 Original CRISPR TTTCTCCATTTCAGCTATTT TGG Intergenic
No off target data available for this crispr