ID: 1043903371

View in Genome Browser
Species Human (GRCh38)
Location 8:85794279-85794301
Sequence AGCTATTTTGGCAGTTGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043903364_1043903371 16 Left 1043903364 8:85794240-85794262 CCTCTGCTAGTCACCAGCCTGAA No data
Right 1043903371 8:85794279-85794301 AGCTATTTTGGCAGTTGCCTAGG No data
1043903366_1043903371 -1 Left 1043903366 8:85794257-85794279 CCTGAAGCCCTTTCTCCATTTCA No data
Right 1043903371 8:85794279-85794301 AGCTATTTTGGCAGTTGCCTAGG No data
1043903368_1043903371 -9 Left 1043903368 8:85794265-85794287 CCTTTCTCCATTTCAGCTATTTT No data
Right 1043903371 8:85794279-85794301 AGCTATTTTGGCAGTTGCCTAGG No data
1043903365_1043903371 3 Left 1043903365 8:85794253-85794275 CCAGCCTGAAGCCCTTTCTCCAT No data
Right 1043903371 8:85794279-85794301 AGCTATTTTGGCAGTTGCCTAGG No data
1043903367_1043903371 -8 Left 1043903367 8:85794264-85794286 CCCTTTCTCCATTTCAGCTATTT No data
Right 1043903371 8:85794279-85794301 AGCTATTTTGGCAGTTGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043903371 Original CRISPR AGCTATTTTGGCAGTTGCCT AGG Intergenic
No off target data available for this crispr