ID: 1043904976

View in Genome Browser
Species Human (GRCh38)
Location 8:85806446-85806468
Sequence ATGGAGAAAGGGCTTCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043904976_1043904982 3 Left 1043904976 8:85806446-85806468 CCAGCCTGAAGCCCTTTCTCCAT No data
Right 1043904982 8:85806472-85806494 AGCTATTTTGGCAGTTGCCTAGG No data
1043904976_1043904980 -9 Left 1043904976 8:85806446-85806468 CCAGCCTGAAGCCCTTTCTCCAT No data
Right 1043904980 8:85806460-85806482 TTTCTCCATTTCAGCTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043904976 Original CRISPR ATGGAGAAAGGGCTTCAGGC TGG (reversed) Intergenic
No off target data available for this crispr