ID: 1043904980

View in Genome Browser
Species Human (GRCh38)
Location 8:85806460-85806482
Sequence TTTCTCCATTTCAGCTATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043904975_1043904980 4 Left 1043904975 8:85806433-85806455 CCTCTGCTAGTCACCAGCCTGAA No data
Right 1043904980 8:85806460-85806482 TTTCTCCATTTCAGCTATTTTGG No data
1043904976_1043904980 -9 Left 1043904976 8:85806446-85806468 CCAGCCTGAAGCCCTTTCTCCAT No data
Right 1043904980 8:85806460-85806482 TTTCTCCATTTCAGCTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043904980 Original CRISPR TTTCTCCATTTCAGCTATTT TGG Intergenic
No off target data available for this crispr