ID: 1043904980 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:85806460-85806482 |
Sequence | TTTCTCCATTTCAGCTATTT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1043904975_1043904980 | 4 | Left | 1043904975 | 8:85806433-85806455 | CCTCTGCTAGTCACCAGCCTGAA | No data | ||
Right | 1043904980 | 8:85806460-85806482 | TTTCTCCATTTCAGCTATTTTGG | No data | ||||
1043904976_1043904980 | -9 | Left | 1043904976 | 8:85806446-85806468 | CCAGCCTGAAGCCCTTTCTCCAT | No data | ||
Right | 1043904980 | 8:85806460-85806482 | TTTCTCCATTTCAGCTATTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1043904980 | Original CRISPR | TTTCTCCATTTCAGCTATTT TGG | Intergenic | ||
No off target data available for this crispr |