ID: 1043904982

View in Genome Browser
Species Human (GRCh38)
Location 8:85806472-85806494
Sequence AGCTATTTTGGCAGTTGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043904976_1043904982 3 Left 1043904976 8:85806446-85806468 CCAGCCTGAAGCCCTTTCTCCAT No data
Right 1043904982 8:85806472-85806494 AGCTATTTTGGCAGTTGCCTAGG No data
1043904979_1043904982 -9 Left 1043904979 8:85806458-85806480 CCTTTCTCCATTTCAGCTATTTT No data
Right 1043904982 8:85806472-85806494 AGCTATTTTGGCAGTTGCCTAGG No data
1043904977_1043904982 -1 Left 1043904977 8:85806450-85806472 CCTGAAGCCCTTTCTCCATTTCA No data
Right 1043904982 8:85806472-85806494 AGCTATTTTGGCAGTTGCCTAGG No data
1043904978_1043904982 -8 Left 1043904978 8:85806457-85806479 CCCTTTCTCCATTTCAGCTATTT No data
Right 1043904982 8:85806472-85806494 AGCTATTTTGGCAGTTGCCTAGG No data
1043904975_1043904982 16 Left 1043904975 8:85806433-85806455 CCTCTGCTAGTCACCAGCCTGAA No data
Right 1043904982 8:85806472-85806494 AGCTATTTTGGCAGTTGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043904982 Original CRISPR AGCTATTTTGGCAGTTGCCT AGG Intergenic
No off target data available for this crispr