ID: 1043909917

View in Genome Browser
Species Human (GRCh38)
Location 8:85851909-85851931
Sequence CTGCATGTTAACTCTATGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043909915_1043909917 16 Left 1043909915 8:85851870-85851892 CCAGAAGGAAAAATAGAGAGATT No data
Right 1043909917 8:85851909-85851931 CTGCATGTTAACTCTATGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043909917 Original CRISPR CTGCATGTTAACTCTATGGT TGG Intergenic
No off target data available for this crispr