ID: 1043913397

View in Genome Browser
Species Human (GRCh38)
Location 8:85891232-85891254
Sequence GGACTCTGCTTGTTTAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043913395_1043913397 25 Left 1043913395 8:85891184-85891206 CCAGGTAGCAAACTGTATGTCTT No data
Right 1043913397 8:85891232-85891254 GGACTCTGCTTGTTTAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043913397 Original CRISPR GGACTCTGCTTGTTTAAAAA AGG Intergenic
No off target data available for this crispr