ID: 1043917368

View in Genome Browser
Species Human (GRCh38)
Location 8:85938490-85938512
Sequence CTGTTAAAGAAGAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043917368_1043917370 -10 Left 1043917368 8:85938490-85938512 CCTTCCTCTTTCTTCTTTAACAG No data
Right 1043917370 8:85938503-85938525 TCTTTAACAGAAGCAATGAGAGG No data
1043917368_1043917371 20 Left 1043917368 8:85938490-85938512 CCTTCCTCTTTCTTCTTTAACAG No data
Right 1043917371 8:85938533-85938555 TACTATTTTTCTTTAACCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043917368 Original CRISPR CTGTTAAAGAAGAAAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr