ID: 1043923385

View in Genome Browser
Species Human (GRCh38)
Location 8:86009618-86009640
Sequence CAGGGTAGAGGGTAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5198
Summary {0: 2, 1: 22, 2: 245, 3: 1426, 4: 3503}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043923385 Original CRISPR CAGGGTAGAGGGTAGGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr