ID: 1043924968

View in Genome Browser
Species Human (GRCh38)
Location 8:86026470-86026492
Sequence GTGCAGAAGGAGAGTGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 638
Summary {0: 1, 1: 0, 2: 4, 3: 54, 4: 579}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043924968_1043924974 -2 Left 1043924968 8:86026470-86026492 CCCCACTCACTCTCCTTCTGCAC 0: 1
1: 0
2: 4
3: 54
4: 579
Right 1043924974 8:86026491-86026513 ACTCCTTCAGGGAGAAGACAAGG No data
1043924968_1043924976 3 Left 1043924968 8:86026470-86026492 CCCCACTCACTCTCCTTCTGCAC 0: 1
1: 0
2: 4
3: 54
4: 579
Right 1043924976 8:86026496-86026518 TTCAGGGAGAAGACAAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043924968 Original CRISPR GTGCAGAAGGAGAGTGAGTG GGG (reversed) Intronic
900094107 1:933438-933460 GCCCAGAAGGAAAGTGAGGGAGG - Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
900828515 1:4946851-4946873 TTGCAGATGGAGAATGTGTGTGG + Intergenic
901498277 1:9635380-9635402 ATGCAGAGGAAGAGAGAGTGGGG - Intergenic
901710054 1:11106770-11106792 CTGCAGAAGGCCAGTGAGGGTGG + Exonic
902777286 1:18682907-18682929 GTGGAGAAGGGGATTGAGTGAGG - Intronic
902969320 1:20035145-20035167 GTACAGAAAGAGAGGGAGAGAGG + Intronic
903306170 1:22414745-22414767 GTGGGGAAGGAGAGTGACAGTGG - Intergenic
903373031 1:22849126-22849148 GTGCAGCAGCAGTGGGAGTGGGG - Intronic
903694892 1:25199390-25199412 GTGCAGAAGGAGAAGGTGGGAGG + Intergenic
903766792 1:25740280-25740302 GTGGAGGAGGAGAGGCAGTGAGG + Intronic
904043471 1:27597293-27597315 ATGCAGAATGAGTGTGAGGGTGG + Intronic
904497240 1:30893808-30893830 GGGTAGCAGGAGAGGGAGTGTGG - Intronic
904920580 1:34004892-34004914 AGGAAGAAGGAGAGCGAGTGAGG - Intronic
905456815 1:38094052-38094074 GTTCAGTAAGAGAGTGAGCGTGG + Intergenic
905822085 1:41000776-41000798 GTGCAGAAAGAGAGAGATTTGGG + Intronic
907679619 1:56551048-56551070 GTGCAGTAGGACAGGGAGGGAGG - Intronic
908768353 1:67573786-67573808 GTGGTCAAGGAGAGTGAGTGAGG - Intergenic
908785386 1:67730207-67730229 GTGAAAAAGGAGACTGGGTGTGG + Intronic
909381467 1:75003753-75003775 GGGAAGGAGGAGAGTGAGAGAGG - Intergenic
910120064 1:83777750-83777772 GTGCAGAATGAAAGAGAATGGGG - Intergenic
914764007 1:150622228-150622250 GGGAAGAAGGGCAGTGAGTGTGG - Intronic
915245352 1:154552351-154552373 GTTGAGGAGGAGTGTGAGTGGGG - Intronic
915271314 1:154755767-154755789 GTGGAGGAGGAGAGAGAGAGGGG + Intronic
915488668 1:156239581-156239603 GTGCTGAGGGAGCCTGAGTGAGG + Exonic
915903061 1:159860062-159860084 ACGCAGACGGAGAGTGTGTGAGG - Intronic
916030107 1:160869179-160869201 GGGTAGAAGGAGAGTGAGAGAGG + Intergenic
916073998 1:161189665-161189687 GTGCATATGGAGAGTGGATGTGG + Exonic
916384710 1:164254618-164254640 GTGGAGCAGGAGAGAGAGTTGGG - Intergenic
917028240 1:170664447-170664469 CCGCAGCAGGACAGTGAGTGAGG + Exonic
917706623 1:177641222-177641244 GGGCAGAAGAAGACTAAGTGTGG - Intergenic
918432658 1:184478180-184478202 GTCCAAAAGGGGAGTGAGTGAGG + Intronic
918590607 1:186237016-186237038 GCGAAGAAGCAGAGTGTGTGAGG + Intergenic
920416404 1:205801571-205801593 GTTCAGAAGGAGAGTTGCTGTGG - Intronic
921192602 1:212724198-212724220 GTGGAGAGGGAGAGGGAGAGGGG - Intergenic
921365651 1:214371224-214371246 GTTAAGAAAGAGAGTGACTGGGG - Intronic
922197984 1:223376261-223376283 AGGCAGAAGGAGTGAGAGTGCGG - Intergenic
922546766 1:226463939-226463961 TGGTAGAAGGAGAGTAAGTGAGG + Intergenic
922794486 1:228333323-228333345 GGTGAGAAGGAGAGGGAGTGGGG + Exonic
922796790 1:228343484-228343506 ATGCAGACGCAGAGTGCGTGTGG + Intronic
923512111 1:234661578-234661600 GTGCAGCAGGACAGGGAGGGGGG + Intergenic
924817397 1:247454653-247454675 GTGCTGAACTAGAGTGAATGAGG - Intergenic
1062825393 10:564378-564400 GGTGAGAAGGGGAGTGAGTGAGG - Intronic
1062881801 10:985014-985036 GTGCAAAAGGAGAGTGGCTTTGG + Intergenic
1063332343 10:5173397-5173419 GTGCAGAATGAGGAGGAGTGGGG + Intergenic
1063880644 10:10528294-10528316 GGGCAGAAAGAAGGTGAGTGTGG + Intergenic
1064145723 10:12824540-12824562 GAGCAAATGGAGAGTAAGTGTGG + Exonic
1064416728 10:15156294-15156316 GAGAAGAATGAGAGTGAGGGGGG - Intronic
1064857166 10:19782365-19782387 GGGCTGACGGAGAGTTAGTGTGG - Intronic
1065408158 10:25391204-25391226 GTGCAGAAGGAAAATGTGGGTGG + Intronic
1066224977 10:33373418-33373440 GTGCAGAATGAGAGTCATTAAGG + Intergenic
1067277904 10:44850916-44850938 GTGCAGCAGGACAGAGAGGGTGG - Intergenic
1067477361 10:46575856-46575878 GTGGAGAAGGAGGGTGGGAGGGG + Intergenic
1067617379 10:47765928-47765950 GTGGAGAAGGAGGGTGGGAGGGG - Intergenic
1067937046 10:50622263-50622285 GTGCAGAAGGGGAGAGGGCGGGG - Intronic
1067971297 10:50973739-50973761 GTGGTGAAGGAGCCTGAGTGTGG - Intergenic
1068434129 10:56968901-56968923 GTGAAGAAGCAGATTGAGTAGGG + Intergenic
1068731012 10:60357861-60357883 TTGCAGAAGGAGAGAGAGTAGGG - Intronic
1069290390 10:66772005-66772027 GTGTGTAAGGAGAGTGAGTGGGG + Intronic
1069994997 10:72336514-72336536 GAGAAGCAGCAGAGTGAGTGTGG - Exonic
1070258095 10:74827198-74827220 GTGCAGAGGGAGAGTTAGGGAGG + Intronic
1071089382 10:81901043-81901065 GTGGAAAAGGAGAGAGAGTAGGG - Intronic
1071902073 10:90131428-90131450 GCGGAGGAGGAGAGAGAGTGAGG - Intergenic
1072400467 10:95093702-95093724 TTGAAGAGGGAGAGTGAGAGGGG + Intergenic
1073080747 10:100859104-100859126 GAGCAGAAAGAGAGAGAGTGGGG - Intergenic
1073125117 10:101144588-101144610 GTGCAGAAGGAGAGGGGATCTGG - Intergenic
1073192155 10:101659212-101659234 TTGCCGAAGGGGAGTGAGGGAGG - Intronic
1073451148 10:103610132-103610154 GAGCTGAGGCAGAGTGAGTGAGG + Intronic
1074111051 10:110423116-110423138 GTGCAGAGGGTGAGTGAATGGGG + Intergenic
1074911634 10:117914977-117914999 GTGCAGAGGGAGAGAGACAGGGG + Intergenic
1075096195 10:119473236-119473258 GGGAAGCAGGAGAGTGAGAGAGG + Intergenic
1075096606 10:119475507-119475529 GGGCAGGAGGAAAGTGAGCGTGG - Intergenic
1075570893 10:123544015-123544037 GTCCAGAAGGATAGAGATTGGGG - Intergenic
1075745120 10:124721753-124721775 GTTCACAGGGAGAGTGAGTAAGG - Intronic
1076602735 10:131669513-131669535 GTGGAGAAAGAGAGAGAGGGGGG + Intergenic
1079987939 11:27217965-27217987 CTGCAGATGGATAGTCAGTGGGG - Intergenic
1080431317 11:32202660-32202682 CTGTAGGAGGAGAGTGAGAGGGG + Intergenic
1081483501 11:43509527-43509549 CTGCAGAAGGAAAGAGGGTGTGG + Intergenic
1081665796 11:44916455-44916477 GTGCAGAAGGGGAGTGAATGTGG - Intronic
1083690138 11:64402940-64402962 GTGCACAAGGAGAGTGAGGTTGG - Intergenic
1084294109 11:68199338-68199360 GTGGAGAAGGAGGGTGATAGTGG + Intronic
1084304283 11:68271724-68271746 GGGCAGTGGGAGAGTGAGTGGGG - Intronic
1084313799 11:68332085-68332107 CTGCAGAAGGCGGGAGAGTGGGG - Intronic
1084605928 11:70171624-70171646 GTGGAGAAGGGGTGTGAGTTTGG + Intronic
1084726714 11:70946696-70946718 GTGGAGAGGGAGGGTGAGTCTGG - Intronic
1084726742 11:70946805-70946827 GTGGAGAGGGAGGGTGAGTCTGG - Intronic
1085014926 11:73167692-73167714 GGCCAAAAGGAGAGGGAGTGGGG - Intergenic
1085255554 11:75170720-75170742 TTCCAGAAGGAGAGTGGGCGGGG - Intronic
1085523840 11:77153226-77153248 ATGCAGATGGAGAGTGGGAGTGG + Intronic
1085837463 11:79972236-79972258 GTGCAGAAGGAGAGAGAGAATGG - Intergenic
1086426472 11:86688723-86688745 GTGAACAAGGAGAGGGAGAGAGG + Intergenic
1086631336 11:89023305-89023327 GAGCAGAAGAAGAGTGTTTGGGG - Intronic
1086954728 11:92924361-92924383 GAGCAGAAGGAAAGAGAGTTGGG - Intergenic
1087245423 11:95829985-95830007 ATGTAGAAGGAGAGGGAGTTAGG + Intronic
1088432041 11:109769220-109769242 GTGCAGAAGCAGAGTGATACAGG + Intergenic
1089016998 11:115173452-115173474 GCGGAGAAGGAGAGAGAGCGCGG + Exonic
1089067402 11:115672363-115672385 CTGCAGAAGGAGAGGGCTTGGGG + Intergenic
1089462396 11:118660841-118660863 GAGCAGCAGGAGGGTGAGGGAGG - Intronic
1089683573 11:120132999-120133021 GTGAAGGAGGAGACTGAGGGGGG - Intronic
1090617295 11:128526892-128526914 GTGAAAAATGAGTGTGAGTGAGG + Intronic
1091204551 11:133810865-133810887 GAGCAGTAGGAGAATGGGTGGGG + Intergenic
1091212791 11:133877512-133877534 GTGCACATGGAGAGTAACTGAGG + Intergenic
1091780694 12:3212951-3212973 GTGGACAAGCAGAGGGAGTGGGG + Intronic
1092976127 12:13746563-13746585 ATACAGAGGGTGAGTGAGTGGGG - Intronic
1093832610 12:23782394-23782416 ATGCAGAAGCAGAATGACTGTGG + Intronic
1094717126 12:33023623-33023645 GGGGAGAAGGAGAGAGAGAGGGG + Intergenic
1094765407 12:33588799-33588821 GTGCAGCAGGTGTGTGTGTGTGG + Intergenic
1095572255 12:43696674-43696696 GTGCAAAAGGAGGGTGGGAGCGG - Intergenic
1095602521 12:44029608-44029630 TTGCAGAAAGAGAGAGAGAGAGG - Intronic
1095715486 12:45341755-45341777 GTGTAGAGGCAGAGTGAGTGGGG + Intronic
1095905397 12:47372145-47372167 GTCCAGAAGGAGACTGGGAGAGG + Intergenic
1096091880 12:48907569-48907591 GTGAAGAAGTAGAGATAGTGAGG - Intronic
1096113418 12:49041641-49041663 GTGCAGAAGGTGAGTGGGGCTGG - Exonic
1096611123 12:52802463-52802485 GTGAAAATGGTGAGTGAGTGTGG - Intergenic
1098449432 12:70602655-70602677 GTGCAGTGGGGGAGTGGGTGGGG + Intronic
1098773108 12:74579964-74579986 GTGGAGGAGGAGAGGTAGTGAGG - Intergenic
1101166319 12:102037617-102037639 GAGCTGGAGAAGAGTGAGTGAGG + Intronic
1101809032 12:108091946-108091968 CTGGGGAAGGAGAGTGGGTGTGG - Intergenic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1103026351 12:117577346-117577368 TTACAGAAGGAGAGAGAGAGAGG + Intronic
1103221898 12:119253169-119253191 GTGCAGCAGCAGAGGGAATGAGG - Intergenic
1103359583 12:120346021-120346043 GGGCAAAAGGAGGGTGAGGGAGG - Intronic
1103985234 12:124762551-124762573 GTGCAGAAGGTGTGTCAGTCAGG + Intergenic
1104215042 12:126726619-126726641 GCGCAGGAGGAGAGAGAGCGCGG - Intergenic
1104733298 12:131120956-131120978 GGGCAGGAGGAGAGGGTGTGGGG + Intronic
1104795079 12:131511652-131511674 GTGCACGTGGAGACTGAGTGAGG + Intergenic
1105478962 13:20755570-20755592 GTGAGGAAGGAGAGGAAGTGAGG - Intronic
1105705678 13:22966221-22966243 GTGCTGCAGCAGAGGGAGTGGGG + Intergenic
1105812014 13:24003928-24003950 CTGCAGGAGGAGGGGGAGTGTGG - Intronic
1105858581 13:24391206-24391228 GTGCTGCAGCAGAGGGAGTGGGG + Intergenic
1106097612 13:26662014-26662036 GTGCAGAAGCACAGAGTGTGAGG + Intronic
1106560381 13:30840580-30840602 GTGGAGACGGAGAGGGAGAGGGG + Intergenic
1106790595 13:33151833-33151855 ATGCAAAAGGGGAGTGAGAGTGG + Intronic
1107714013 13:43180660-43180682 GGGCAGATGGAGCGTGGGTGGGG - Intergenic
1109225472 13:59689307-59689329 GTGAAGAAGGAGACAGGGTGTGG - Intronic
1109595561 13:64549230-64549252 GTGGAGCAGGAGAGAGAGCGAGG - Intergenic
1110901710 13:80833301-80833323 CAGGAGAAGGAGAGAGAGTGGGG + Intergenic
1111104556 13:83628849-83628871 CAGGAGAAGGAGAGTGAGGGGGG - Intergenic
1111711737 13:91824337-91824359 GGGTAGAAGGAGAGAGACTGAGG + Intronic
1112373941 13:98821260-98821282 GGGCAGGAGGAGAGTGAGGTGGG + Intronic
1113011002 13:105765571-105765593 GTGCATGTGGGGAGTGAGTGAGG - Intergenic
1113898685 13:113783706-113783728 GTGGAGAAGGAGGATGGGTGAGG + Intronic
1114834208 14:26184331-26184353 CTGCAGAAGAATAGTGAATGTGG + Intergenic
1116394425 14:44430575-44430597 GTGGAGAAGGAGGAGGAGTGGGG - Intergenic
1117081045 14:52152039-52152061 GTACAGGAGGAGAGTTAGGGAGG - Intergenic
1117842015 14:59870320-59870342 GCGCAGAAGGGGACTGACTGGGG + Intronic
1118599449 14:67461546-67461568 GTCCAGAAGGAGGGAGAGTGAGG - Intronic
1118791452 14:69096985-69097007 GTGCAGAAGGAGGGGGTGGGAGG + Intronic
1119715481 14:76856111-76856133 GAGCAGAAGCAGAGAGAATGAGG - Intronic
1119754459 14:77105258-77105280 GGGCAGAAGGAGGGGGAGAGGGG - Intronic
1120352725 14:83383608-83383630 GTGAAGGAGGAGAGGTAGTGGGG - Intergenic
1120886347 14:89454889-89454911 CTGGAGAAGGAGAGGGAGTGGGG + Intronic
1121526065 14:94620392-94620414 GTGCAGGAGCAGAGAGAGTGAGG + Intronic
1121697935 14:95928252-95928274 GGGCAGAGGGAGAGGGAGAGAGG - Intergenic
1121793849 14:96719798-96719820 GTGGAGAGAGAGAGAGAGTGGGG + Intergenic
1121992646 14:98574639-98574661 GTTCAGCAGGAGAATGATTGGGG - Intergenic
1122389017 14:101367795-101367817 GTGGAGAAGAAGAGCGGGTGAGG + Intergenic
1122587637 14:102820341-102820363 GTGCAGAAGGTTAGGAAGTGAGG - Intronic
1123035103 14:105468794-105468816 GTGGGGAAGGGCAGTGAGTGGGG + Intronic
1123038235 14:105479952-105479974 GGGCAGCAGGAGAGGGAGAGCGG - Intronic
1123193894 14:106598087-106598109 GGGCAGCAGGAGAGAGAGAGAGG - Intergenic
1124702760 15:31931165-31931187 GAGCACATGGAGAGTGGGTGGGG - Intergenic
1125691475 15:41599527-41599549 CAGCAGAAGGAGAGTGAGGGTGG + Intergenic
1126899919 15:53304512-53304534 TTGCAGTAGGGGAGTGAGAGGGG + Intergenic
1126961148 15:53995878-53995900 GTGGAGAAGTAGAGAGAGAGAGG + Intergenic
1127357772 15:58217363-58217385 GTGGAGCAGGAGAGAGAGAGAGG + Intronic
1127668439 15:61171572-61171594 GTCCAGAAGTGGAGTGGGTGGGG - Intronic
1127915078 15:63448688-63448710 GTGCAGAGAGAGAGAGACTGTGG + Intergenic
1128582211 15:68818309-68818331 GTGCCGAAGGTGGGTGTGTGGGG + Intronic
1128767561 15:70260489-70260511 CTGCAGCAGCAGAATGAGTGTGG - Intergenic
1129297393 15:74607303-74607325 CTTGAGAAGGAGAGTGGGTGAGG - Intronic
1129685355 15:77683146-77683168 GGGGAGAAGCAGAGTGAGTGTGG + Intronic
1130387382 15:83423568-83423590 GAGCAGAAAGAGAGGGAGAGAGG + Intergenic
1131084934 15:89568039-89568061 GTACAGAAGGAGAGAGCATGAGG + Intergenic
1131312560 15:91304207-91304229 CTGCAGGAGGAGAGAGAGGGGGG + Intergenic
1131630259 15:94168622-94168644 TTGCAGGAGGCAAGTGAGTGAGG + Intergenic
1131826950 15:96330114-96330136 TTGCAGAGGGATAGGGAGTGAGG - Intronic
1132547937 16:541822-541844 GTGCAGAAGGTGCGTGGATGTGG + Intronic
1132547949 16:541877-541899 GTGCAGAAGGTGCGTGGATGTGG + Intronic
1132547961 16:541932-541954 GTGCAGAAGGTGCGTGGATGTGG + Intronic
1132547973 16:541987-542009 GTGCAGAAGGTGCGTGGATGTGG + Intronic
1132732117 16:1367642-1367664 GTGAAGCAGGTGAGTGTGTGGGG - Intronic
1132995210 16:2819151-2819173 GGCCAGAAGGAGAGTGTGAGAGG + Intronic
1133506669 16:6418938-6418960 GAGCAGAAGGAAAGTGATTTTGG + Intronic
1133751247 16:8727341-8727363 GTGCACAGTGAGAGTGGGTGTGG - Intronic
1134759477 16:16701336-16701358 CTGCAGAAGGAGATGGAGTGAGG - Intergenic
1134821732 16:17252497-17252519 GTGCAGAGGGAGATGCAGTGAGG - Intronic
1134986593 16:18657858-18657880 CTGCAGAAGGAGATGGAGTGAGG + Intergenic
1135053125 16:19208452-19208474 TGGCAGCAGGAGAGTGAGGGGGG + Intronic
1135197124 16:20403779-20403801 GTGCGGGAGGAGAGAGAGAGAGG - Intronic
1135562624 16:23488213-23488235 GTGCAGAAGGATAGCCCGTGGGG - Intronic
1135812234 16:25598754-25598776 TGGCCGAAGCAGAGTGAGTGAGG + Intergenic
1135928498 16:26716240-26716262 CTGCAGAATGTGAGTGAGAGTGG - Intergenic
1136487269 16:30581657-30581679 TTGCAGAATGAGAGTGGGGGGGG + Exonic
1136615217 16:31394347-31394369 TTGGGGAAGGAGGGTGAGTGGGG - Intronic
1137578750 16:49621010-49621032 CTGCTGAAGGAGAGAGAGGGAGG - Intronic
1137836077 16:51593986-51594008 CTGCAGAAGGAAACTGAGGGAGG - Intergenic
1137844580 16:51674641-51674663 AATCAGAAGGAGAGTGAGTGAGG + Intergenic
1138144846 16:54599255-54599277 GTGCAGCAGTAGAGTGAGTGAGG - Intergenic
1138512594 16:57517185-57517207 GTGCTGGAGGGGAGTGAGCGGGG - Intronic
1138772022 16:59676702-59676724 GTGGGGAAAGAGAGTGAGTTAGG - Intergenic
1139490616 16:67284110-67284132 GTGGAGAAGGGGAGTGGATGTGG + Intronic
1140041934 16:71413867-71413889 GTGCAGGAGGAGGGTGGGTTAGG + Intergenic
1140249792 16:73286188-73286210 GTGCAGGAGGAGGGGGAGAGGGG - Intergenic
1140875400 16:79147234-79147256 GCGCAGAAGGAAGGTGGGTGTGG - Intronic
1141241613 16:82270283-82270305 GGGCAGAATGAAAGAGAGTGAGG + Intergenic
1142107806 16:88315671-88315693 GTGCAGAAGGTGGGGGAGGGAGG + Intergenic
1142416560 16:89946604-89946626 AGGGAGAAGGTGAGTGAGTGAGG + Intergenic
1142605067 17:1076915-1076937 GTGGAGAGGGAGAGTGGGTGAGG - Intronic
1143738305 17:8930877-8930899 GTGCAGGAGGGAAGTGGGTGTGG + Intronic
1144023870 17:11260730-11260752 AGACAGAAGGAGAGTGAGAGGGG - Intronic
1144237497 17:13275809-13275831 GGGAAGAAGAAGAGTGACTGAGG - Intergenic
1144238585 17:13287070-13287092 GTGCAGATGGAAAGAGAGAGAGG - Intergenic
1144465540 17:15493810-15493832 CTGCAGAGGGAGAGAGAGAGAGG - Intronic
1144561846 17:16327199-16327221 GTGCAGTAGGAGAGTGTGGTAGG + Intronic
1144698357 17:17320988-17321010 GAGCAGGAGGCGAGGGAGTGGGG + Intronic
1145875742 17:28317437-28317459 GAGCTGAAGAAGAGTGATTGAGG - Intergenic
1146401715 17:32504919-32504941 GTGGAGAAGGAGCGGGAGCGGGG - Intronic
1146948841 17:36891997-36892019 GTGGAGAAGCAGAGTGAAAGAGG + Intergenic
1149030230 17:52074055-52074077 GGGGAGAAGGAGGGTGAGTCAGG - Intronic
1149552780 17:57552394-57552416 ATGCAGCAGGGCAGTGAGTGGGG - Intronic
1149627558 17:58090535-58090557 GTGCAGAGGGACAGTGACTGTGG + Exonic
1149739120 17:59026748-59026770 GTGTAGCAGAAGAGTGAATGAGG - Intronic
1150337857 17:64343363-64343385 GCACAGAGGGAGAGTGAGTGTGG - Intronic
1150557178 17:66264834-66264856 GAGAAGAATGAGAATGAGTGGGG - Intergenic
1151366955 17:73623726-73623748 GTGAAGAAGCAGAGAGAGTCGGG - Intronic
1151427399 17:74040073-74040095 GTGCAGAAGCAGGAAGAGTGAGG + Intergenic
1151949350 17:77341348-77341370 GAGCAGAGGGAGAGAGAGCGGGG + Intronic
1152246991 17:79190044-79190066 ATGCTGAAGGAGAGCAAGTGGGG - Intronic
1152866867 17:82729385-82729407 GTGAGGAAGGACCGTGAGTGTGG + Intronic
1153428600 18:4991599-4991621 GTGGAGAAAGAGAGAGAGGGAGG + Intergenic
1153711994 18:7809463-7809485 GAGAAGAAGGGGTGTGAGTGCGG - Intronic
1155075156 18:22348414-22348436 GAGCAGAAAGAGAGAGAGTTTGG - Intergenic
1155596348 18:27492510-27492532 GTCCATAAGGAAAGTGAGTATGG + Intergenic
1157408077 18:47440526-47440548 GAGAAGAAGGAGAGTGAGGGAGG + Intergenic
1157616986 18:48992785-48992807 GAGCAGGAGCAGACTGAGTGTGG - Intergenic
1157901704 18:51524287-51524309 AGGCAGAAGGAGAGTGAGCTAGG + Intergenic
1158116618 18:54003389-54003411 AAGCAGAAGTAGAGTGTGTGTGG - Intergenic
1158392668 18:57056310-57056332 GTGCAGAAGGAGAGGGCGATGGG + Intergenic
1159977139 18:74727971-74727993 GGGGAGAAGGAGAGTGATGGAGG + Intronic
1160872096 19:1282280-1282302 GTGTAAAAGGAGAGGGAGAGAGG + Intergenic
1162185113 19:8898712-8898734 GTGCAGAAATAAGGTGAGTGAGG + Intronic
1162536917 19:11268084-11268106 GTGAAGAGGGAGGTTGAGTGAGG + Intergenic
1162996649 19:14340046-14340068 GGGGAGAAGGAGAGTGAGGAAGG - Intergenic
1163017786 19:14467418-14467440 TGGCTGGAGGAGAGTGAGTGAGG + Intronic
1164737504 19:30552732-30552754 GTGCAGAAGGAGAGCCACCGAGG + Intronic
1165270997 19:34707630-34707652 GGGCAGAATGGGAGAGAGTGGGG + Intergenic
1165708485 19:37992914-37992936 GTGCAGGGCGAGTGTGAGTGCGG + Intronic
1165822519 19:38685585-38685607 TTTCAGAAGCAGAGTGAGTTTGG - Intronic
1166503589 19:43357928-43357950 GTTGAGAGGGAGAGTGTGTGTGG - Intronic
1166506865 19:43376833-43376855 GTTGAGAGGGAGAGTGTGTGTGG + Intergenic
1166580661 19:43895805-43895827 GTGGAGGAGGAGAGGGAGGGAGG + Intronic
1166770785 19:45280754-45280776 GGGGAGAAGGAGGGTGCGTGAGG - Intronic
1167745276 19:51347072-51347094 GTGTAGGAGGAGAGTGGGTGAGG + Intronic
1168053509 19:53847627-53847649 GTGCTGGAGGAGAGTGAACGAGG - Intergenic
1168336828 19:55601833-55601855 ATCCAGAAGGAGAGTTAGGGAGG + Intronic
925156609 2:1653115-1653137 GTGCCAGAGCAGAGTGAGTGGGG + Intronic
925198577 2:1947756-1947778 TTGGAGAAGGTGAGTGTGTGTGG + Intronic
925608765 2:5685459-5685481 GTGCAGGAGGAGGGTGTCTGTGG - Intergenic
925729707 2:6910382-6910404 GTGTAGAAAGAGAGAGAGAGAGG + Intergenic
925759206 2:7168159-7168181 CTGCAGCAGGAGGGTGAGAGTGG + Intergenic
925804598 2:7635824-7635846 GTGCAGAGCGAGAGTGGCTGGGG - Intergenic
926230820 2:11002633-11002655 GTGCAGAAAGGGAGTGAGGAAGG + Intergenic
926283961 2:11472702-11472724 CAGGAGAAAGAGAGTGAGTGAGG + Intergenic
926358088 2:12059559-12059581 GTGCTGTGGGAGAGTGAGTGGGG + Intergenic
926383815 2:12316640-12316662 GTGCAGAGGGAGAGACAGTCAGG + Intergenic
926746555 2:16163291-16163313 GTCCAGCAGGAGAGTGATAGTGG + Intergenic
927015890 2:18961394-18961416 TTGCAGTGGGAGAGGGAGTGTGG - Intergenic
927289261 2:21388729-21388751 GTGCAGAAGGATGATGAGAGGGG + Intergenic
927466140 2:23338103-23338125 GTGGAGAGGGAGAGTGGATGGGG + Intergenic
928395303 2:30939246-30939268 GTGCAGAATGAGGGAGAGGGTGG + Intronic
929139531 2:38654830-38654852 CTCCAGAAGGAGAGAGAGAGAGG - Intergenic
930257527 2:49109253-49109275 TTGCAGGAGCAGAGTGGGTGGGG + Intronic
930656547 2:54012931-54012953 GAGCAGAGGGAGAGGGAGAGTGG - Intronic
931744734 2:65282104-65282126 GTGGAGAGGGAGAGGGAGGGAGG - Intergenic
931821219 2:65954319-65954341 GTGCACAAGGAGAGATAGAGAGG - Intergenic
932123775 2:69125168-69125190 ATGAAGCAGGAGAGAGAGTGGGG + Intronic
932812172 2:74834635-74834657 GTGCAGAAGGTAAGTCAGCGCGG + Exonic
932849862 2:75174027-75174049 GTGAGGCAGGAGAGTGTGTGAGG - Intronic
932871688 2:75406634-75406656 GTGCAGAAGGAGACGGAGCATGG - Intergenic
932915850 2:75856787-75856809 GAGCAGCAGGAGAGAGAATGAGG - Intergenic
933331331 2:80896408-80896430 GTGCAGATGGACAGAGAGCGGGG + Intergenic
934047332 2:88183591-88183613 GGGAAGAAGGAGAGCGAGGGAGG - Intronic
934067078 2:88350498-88350520 CTGCAGGTGGAGAGGGAGTGGGG + Intergenic
934167134 2:89304399-89304421 GTGTAGCAGGAGGGTGAGTCTGG - Intergenic
934200144 2:89878045-89878067 GTGTAGCAGGAGGGTGAGTCTGG + Intergenic
934781279 2:96971254-96971276 GGGGAGAAGGAGAGAGAGGGAGG - Intronic
935830690 2:106998117-106998139 GGGCAGAAGGAGCATCAGTGAGG + Intergenic
936340097 2:111623500-111623522 CTGCTGAAGGAGAGTGGGTGTGG - Intergenic
936937176 2:117849593-117849615 GTGAAGTAAGATAGTGAGTGAGG + Intergenic
937425729 2:121797041-121797063 AGGAAGAAGAAGAGTGAGTGAGG - Intergenic
938079838 2:128364060-128364082 GTGCAGATGGGTAGTGAGAGAGG + Intergenic
938718021 2:134038909-134038931 GTGGAGCAGGAGAGAGAGTGAGG + Intergenic
938718292 2:134040958-134040980 GTGAAGCAGGAGAGACAGTGAGG + Intergenic
939482728 2:142770021-142770043 GAGCAGGAGGAAAGTGTGTGTGG - Intergenic
940484685 2:154282544-154282566 ATGCAGAAGAAGAGGGAATGAGG - Intronic
940671401 2:156673446-156673468 AGGCAGAAGGGGAGAGAGTGAGG - Intergenic
941034235 2:160549983-160550005 GCTGAGAAGGGGAGTGAGTGGGG + Intergenic
941246938 2:163110161-163110183 GTGAAGAAGGAGGGAGAGTATGG - Intergenic
941721361 2:168816475-168816497 GTGATGCAGGAGTGTGAGTGGGG - Intronic
941836481 2:170026048-170026070 GTGCAGAATGAGAGGGAAAGAGG + Intronic
941918027 2:170824600-170824622 GGGCAGGGGGAGAGTGGGTGGGG - Intronic
942069198 2:172300112-172300134 GTTCAGATGGAGAGGGAGGGAGG + Intergenic
942954559 2:181759119-181759141 TTGCAGAAGGTGAGTGAGAATGG + Intergenic
943490229 2:188544102-188544124 TTCCAGTAGGAGAGTGAGGGTGG - Intronic
944294634 2:198048604-198048626 AGGGAGAAGGAGAGAGAGTGGGG + Intronic
944313041 2:198256716-198256738 GAGCAGATGGAGAGTCAGGGAGG - Intronic
945073697 2:206015977-206015999 GTGCAGAAGGAAAATGTGGGTGG + Intronic
945407688 2:209469594-209469616 GTGCAGAGGGAGAGTAAGAAAGG - Intronic
946450900 2:219778168-219778190 GATCAGAAGGAAAGAGAGTGAGG - Intergenic
946733747 2:222733883-222733905 CTGCAGCAGGAGAGTGAGTCTGG - Intergenic
947321579 2:228925173-228925195 GGGCATAAGGAGACTGATTGTGG - Intronic
948702549 2:239769412-239769434 ATGAAGAAGGTGAGTGGGTGAGG + Intronic
949066491 2:241993823-241993845 TTGCAGAAGGAGATGGGGTGGGG + Intergenic
1168797786 20:623004-623026 GTGGGGAAGCAGAGTGGGTGAGG + Intergenic
1170207550 20:13814869-13814891 TTGCAGAAGCAGTGTGAGGGTGG - Intronic
1171177947 20:23068266-23068288 GGTCAGAGGGAGGGTGAGTGGGG - Intergenic
1172544172 20:35746542-35746564 GTGCAGAAGGAACCTGGGTGGGG - Intergenic
1172578726 20:36030222-36030244 GTGCAGAAGGAGAGTCTGGGAGG + Intronic
1172845489 20:37927719-37927741 GGGCAGGAGGAGACTGAGTGGGG + Intronic
1174266685 20:49337024-49337046 GGGCAGGAGCAGAGTGAGTGAGG + Intergenic
1174302109 20:49589892-49589914 GAGCAGAAAGAAAGTCAGTGTGG - Intergenic
1174367952 20:50067764-50067786 CTGCAGGAGGTGAGGGAGTGAGG - Intergenic
1174428278 20:50448804-50448826 TGGCTGGAGGAGAGTGAGTGAGG - Intergenic
1174592083 20:51654094-51654116 GTGCAGAAAGAGAGAGGGGGAGG - Intronic
1176239511 20:64069479-64069501 CTGCAGACGGACCGTGAGTGCGG + Exonic
1176304111 21:5114424-5114446 GTGGAGCAGGGGACTGAGTGTGG + Intergenic
1177836239 21:26189016-26189038 GAGCAGAAGGGGAGCCAGTGAGG + Intergenic
1177966649 21:27736117-27736139 AGGCAAAAGGAGAGAGAGTGTGG + Intergenic
1178154730 21:29838499-29838521 GAGCAGCAGAAGAGTGAGTAGGG - Intronic
1179482670 21:41688298-41688320 TTGAAAAGGGAGAGTGAGTGAGG - Intergenic
1179852945 21:44147606-44147628 GTGGAGCAGGGGACTGAGTGTGG - Intergenic
1179960741 21:44765906-44765928 GAGCAGAAGGAAAGTGGCTGGGG + Intergenic
1180798377 22:18619238-18619260 GAGCTGAAGGAGAGGGAGTGAGG + Intergenic
1181223341 22:21376027-21376049 GAGCTGAAGGAGAGGGAGTGAGG - Intergenic
1181255399 22:21559599-21559621 GAGCTGAAGGAGAGGGAGTGAGG + Intronic
1181573781 22:23781535-23781557 GGGCCGAGGGAGAGAGAGTGTGG + Intronic
1182583045 22:31326742-31326764 GTGGAGAAGGAGTTGGAGTGGGG + Exonic
1182680172 22:32073441-32073463 GGGCAGAAGCAGTGTGAGTCAGG - Intronic
1182707407 22:32294542-32294564 GGGCAGGAGGAAAGTGGGTGTGG - Intergenic
1183480889 22:38064973-38064995 GTGCATAAGGAGAGTGGTGGGGG - Intronic
1183633169 22:39045667-39045689 GAGCACAAGGAGTGTGGGTGAGG - Intronic
1184395748 22:44237995-44238017 GGGCAGGAGGAAAGTGGGTGTGG - Intergenic
1184649726 22:45914041-45914063 GTGCAGGAGAGGAGGGAGTGGGG - Intergenic
1184723977 22:46332388-46332410 GTGTACCAGGAGAGGGAGTGGGG - Intronic
1184744997 22:46451043-46451065 GGGGAGGAGGAGAGGGAGTGGGG - Intronic
1185164859 22:49255322-49255344 GGGCAGTAGGGAAGTGAGTGTGG + Intergenic
1185363765 22:50425151-50425173 GTGGAGAGGGAGAATGAATGGGG - Intronic
949870470 3:8583706-8583728 GTCCAGAAGCAGAGGGAGTGAGG - Intergenic
949904668 3:8849035-8849057 GTGCAGAAGCAGAGACAGGGAGG - Intronic
952733667 3:36666310-36666332 GTCAAGCAGGAGAGGGAGTGGGG - Intergenic
953138708 3:40207182-40207204 GTTCAGAAGTGGAGAGAGTGGGG - Intronic
953524413 3:43676563-43676585 GTGCAGGAGGGAAGTGGGTGTGG + Intronic
953852660 3:46478059-46478081 GGGCATAAGGAGTGTGGGTGTGG - Intronic
956373441 3:68588782-68588804 TGGCAGAAGCAGAGTGAATGAGG + Intergenic
956850954 3:73227917-73227939 GTACAGAAAGAGAGAGAGGGAGG - Intergenic
958015487 3:87935249-87935271 GAGAAAAAGGAGAGGGAGTGTGG + Intergenic
958055040 3:88399421-88399443 ATGCAGGAGCAGAGTGAGTGAGG - Intergenic
959230846 3:103648851-103648873 CTGCAGAATGTGACTGAGTGTGG - Intergenic
959652604 3:108766014-108766036 GAGAAGAAGGAGAGTGAGAGAGG + Intergenic
960745149 3:120879558-120879580 CTGCAGAAGCAGTGTGTGTGGGG + Intergenic
960886734 3:122403503-122403525 GTGCAAAGGGAGAGCCAGTGAGG - Intronic
960987441 3:123290141-123290163 GTCCAGTGGGTGAGTGAGTGTGG - Intronic
961110280 3:124277675-124277697 CTGCAGGAGGAGTGTGGGTGTGG + Intronic
961658780 3:128457426-128457448 GTGCAGAGGGAGAGGAAGAGGGG + Intergenic
961837423 3:129674586-129674608 GTGCAGAGGGAGAGTAAAGGAGG + Intronic
961850239 3:129809654-129809676 GTGCAAAAGAAGAGAGAGAGAGG + Intronic
962209039 3:133461035-133461057 GTTCAGGAGGAGGGAGAGTGAGG - Intronic
962962194 3:140321311-140321333 GTGCTGAAGGTGTGTCAGTGAGG - Intronic
963054764 3:141176950-141176972 GAGTAGGAGGAAAGTGAGTGTGG + Intergenic
963085342 3:141430641-141430663 GTGCAGAGGGGCAGGGAGTGGGG + Intronic
963087457 3:141451432-141451454 GTGGAGAAGGAAAGTAGGTGAGG - Intergenic
963608800 3:147439291-147439313 GAGGAGAGGGAGAGTGACTGGGG + Intronic
964926581 3:161965087-161965109 GTTCAGAAGAAGGGTGAGTCTGG + Intergenic
964974392 3:162601455-162601477 GTTCAAAAAGAGAGTCAGTGAGG - Intergenic
965817870 3:172655507-172655529 CTGGAGAAGGAGAGAGAGTTGGG + Intronic
966064132 3:175796072-175796094 AGGGAGAAGGAGAGAGAGTGGGG + Intronic
966642968 3:182210761-182210783 GGGCAGGAGGAGAGTGAGATGGG + Intergenic
966877161 3:184328978-184329000 GTGCAAAAGCATGGTGAGTGAGG + Exonic
968555809 4:1245911-1245933 GTGTTGAAGGAGAGTGAGGATGG - Intronic
969113426 4:4857353-4857375 TTGCAGAAGGAGGGCGAGGGCGG + Intergenic
969611393 4:8229444-8229466 GAGCAGGGGGTGAGTGAGTGGGG + Intronic
970806575 4:20042947-20042969 ATGCGGAAGGAAAGTGAGTCAGG - Intergenic
971213717 4:24644337-24644359 GTGGAGCAGGAGAGAGAGAGAGG - Intergenic
971278127 4:25217195-25217217 AGGCAGAAGGAGAGAGAGAGTGG + Intronic
972840620 4:42925906-42925928 GTGTAGAAGGAGTTTGGGTGGGG + Intronic
973571057 4:52240053-52240075 GTGATGAAGGGGAGGGAGTGTGG - Intergenic
973571345 4:52242896-52242918 CTCCAGCAGGACAGTGAGTGGGG - Intergenic
973666549 4:53165061-53165083 GGGAACAAGGAGAGTGAGTTAGG - Intronic
974891215 4:67886364-67886386 CTGCTGATGGAGAGAGAGTGTGG + Intergenic
976357572 4:84137131-84137153 GTGCAGAAGCAGAGGCAGGGTGG - Intergenic
976381429 4:84403910-84403932 TGGCAGGAAGAGAGTGAGTGGGG - Intergenic
976771525 4:88658189-88658211 GGGCAGAAGAAGAGTTAGAGTGG + Intronic
977882109 4:102216937-102216959 GAGCAGAAAGTCAGTGAGTGTGG - Intergenic
978269920 4:106876663-106876685 GTGGAGCAGGAGAGGGAGAGGGG - Intergenic
978421972 4:108542664-108542686 GTGAAAAAGGAGAGAGAGTGGGG - Intergenic
978483538 4:109223547-109223569 GTTCTGAAAGAAAGTGAGTGGGG + Intronic
978701091 4:111647115-111647137 GAGGAGAAGGAGAGTGTGTCAGG + Intergenic
978757996 4:112324940-112324962 GAGAAGAAGGAGAGTCACTGAGG + Intronic
981007460 4:139890334-139890356 GTGCGAAGGGAGAGTGAGAGGGG + Exonic
981503235 4:145474554-145474576 GTGGAGCAGGAGAGAGAGCGAGG + Intergenic
981791924 4:148547643-148547665 GTGCTGATGGAGAGTTACTGAGG - Intergenic
982209083 4:153020496-153020518 GTGCAGGAGGAGAGTGGGGAAGG - Intergenic
982222161 4:153134249-153134271 GTGCAGAAGAAAGGTGAGGGAGG - Intergenic
982291532 4:153787894-153787916 GTGCAGAATGAGGCTGAGCGAGG + Intronic
982805943 4:159762635-159762657 GTGGAGACGGAGGGAGAGTGTGG - Intergenic
983253169 4:165368009-165368031 GTGCATAAGGAGAGTCAGGCAGG - Intronic
983562516 4:169115317-169115339 GAGCTGCAGGTGAGTGAGTGAGG + Intronic
984241548 4:177225874-177225896 GGGCAGAATGAGAGTGAGACAGG - Intergenic
984822837 4:183898160-183898182 CTGGAGAAGGAGAGGGAGGGCGG - Intronic
984822955 4:183899206-183899228 GAGCAGAGGGAGAGAGAGAGGGG - Intronic
985140977 4:186840521-186840543 GGAGAGAAGGAGAGGGAGTGGGG - Intergenic
985265268 4:188150968-188150990 GGTGAGAAGGAGAGTGAGAGTGG + Intergenic
985265337 4:188151208-188151230 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985265422 4:188151521-188151543 GTTGAGAAGGGGAGTGAGAGAGG + Intergenic
985265442 4:188151593-188151615 GTTGAGAAGGGGAGTGAGAGAGG + Intergenic
985265469 4:188151689-188151711 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985265496 4:188151785-188151807 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985265509 4:188151831-188151853 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985265522 4:188151879-188151901 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985265556 4:188151999-188152021 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985265571 4:188152045-188152067 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985265716 4:188152576-188152598 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985265743 4:188152672-188152694 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985265762 4:188152744-188152766 GTTGAGAAGGGGAGTGAGAGAGG + Intergenic
985265817 4:188152962-188152984 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985265889 4:188153227-188153249 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985265935 4:188153395-188153417 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985265948 4:188153443-188153465 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985265996 4:188153607-188153629 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985266136 4:188154136-188154158 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985266156 4:188154208-188154230 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985266176 4:188154280-188154302 GTTGAGAAGGGGAGTGAGAGAGG + Intergenic
985266182 4:188154304-188154326 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985266245 4:188154546-188154568 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985266291 4:188154714-188154736 GTTGAGAAGGGGAGTGAGAGTGG + Intergenic
985495725 5:204012-204034 GTCCAGAAGGAGGGTGGGTTTGG - Exonic
985506736 5:285781-285803 GTGCAGATGGAGACCCAGTGGGG + Intronic
985808607 5:2067038-2067060 CTGCAGAAGGTGAGTGAGGTCGG + Intergenic
985862141 5:2479539-2479561 GGGAAGAATGAGAGGGAGTGTGG + Intergenic
986055634 5:4134089-4134111 GGGCAGAAGGACACTGAGGGAGG - Intergenic
986143992 5:5059718-5059740 GTGGAGAAGGAGAGAAAGTTGGG + Intergenic
986463090 5:7993275-7993297 GGGGAGAAAGAGAGAGAGTGAGG + Intergenic
986470751 5:8071897-8071919 TTGCAAAAGGACAATGAGTGGGG - Intergenic
987314315 5:16710125-16710147 GGGCAGAAGGAGCGGGAATGAGG + Intronic
988492332 5:31715408-31715430 GTGCACAAGGAAACTCAGTGGGG - Intronic
988632692 5:32947719-32947741 ATGCAGAAGGAGAGAATGTGTGG + Intergenic
988770287 5:34426568-34426590 TGGCAGAAGGAGAGAGAGAGTGG + Intergenic
988997316 5:36726856-36726878 GTGCAGGAGGTGAGGGAGTGAGG + Intergenic
989281293 5:39646638-39646660 TGGCAGCAGGAGAGAGAGTGAGG - Intergenic
990168830 5:53024750-53024772 AAACAGAAGGAAAGTGAGTGTGG + Intronic
990556671 5:56943241-56943263 CTACAAAAGGAGAGTGACTGAGG + Intronic
990791359 5:59483662-59483684 GAGGAGCAGGAGAGTAAGTGGGG + Intronic
990994982 5:61723657-61723679 GTCTAGAAGGAGAGTAGGTGGGG - Intronic
991466445 5:66917824-66917846 GTGTAAAAGGAGAGTGAAGGAGG - Intronic
992379826 5:76226207-76226229 GGGCAGAAGGAAAATGAGTTGGG + Intronic
992618615 5:78570512-78570534 GTGATGAAGGAGAGTGACAGGGG + Intronic
994190457 5:96863218-96863240 GTGCAGGAAGAGACTGATTGGGG - Intronic
994641855 5:102420876-102420898 ATGCAGAAGGTGAGTGATTTCGG + Intronic
994835136 5:104842110-104842132 GTGTAGAAAGAGAGAGAGGGAGG + Intergenic
995231434 5:109769059-109769081 GCGCATAAGGAGAATTAGTGGGG + Intronic
996789277 5:127275320-127275342 GGGCTGAAGGAGAGTGAGTCAGG + Intergenic
997650785 5:135517683-135517705 GTGGAGAAAGAGAGAGAGAGTGG - Intergenic
997690670 5:135825692-135825714 GGGCAGCAGGCCAGTGAGTGTGG - Intergenic
997741700 5:136260549-136260571 GGGCTGAAACAGAGTGAGTGAGG + Intronic
997852453 5:137344991-137345013 GTGGAGAAGTAGAGCGTGTGTGG - Intronic
998478066 5:142438062-142438084 GTTGAGATGGAGAGTGACTGGGG - Intergenic
998781118 5:145657886-145657908 ATGCAGAAAGATAGTGACTGTGG - Intronic
999321297 5:150616765-150616787 AGGCAGATGGAGAGTGGGTGTGG - Intronic
999375978 5:151086871-151086893 GTGGAGAAGGAGGCTGGGTGAGG + Intronic
999442829 5:151615617-151615639 GTGCTGAAGCAGAATGAGTCAGG + Intergenic
1000302479 5:159968722-159968744 GGGAAGAAGTAGAGTGAGGGAGG - Intronic
1000362973 5:160465282-160465304 GTGGAGACGGGGAGGGAGTGAGG + Intergenic
1001007038 5:168061426-168061448 GTTCTGAAGGATACTGAGTGTGG + Intronic
1001381851 5:171310769-171310791 GAGGAGAAGGAGAGTGCGAGAGG - Intronic
1001649643 5:173306530-173306552 GAGCAGAAGGACAGTGTTTGGGG - Intergenic
1002762570 6:213456-213478 GTGCAGGACGGGAGTGAGAGAGG - Intergenic
1002762578 6:213522-213544 GTGCAGGACGGGAGTGAGAGAGG - Intergenic
1002893944 6:1363797-1363819 CTGCAGAAGGCCTGTGAGTGTGG - Intergenic
1004039206 6:11959273-11959295 GTGGAGAATGAGAGTGTGTCTGG - Intergenic
1004319463 6:14621319-14621341 GTGCAGACAGAGAGGGAGGGTGG - Intergenic
1005958283 6:30679542-30679564 GTGGATGGGGAGAGTGAGTGGGG - Intronic
1006166635 6:32069202-32069224 GTGAGGGAGGAGAGGGAGTGAGG + Intronic
1006459562 6:34150497-34150519 GGGCAGAAGGGCTGTGAGTGGGG + Intronic
1006509394 6:34513716-34513738 TTCCAGAATGAGAGTGAGGGAGG + Intronic
1007077429 6:39076792-39076814 GTGCAGAAGGCCATTGAGGGCGG + Intronic
1007255688 6:40526715-40526737 ATGCAGGAGGAGTTTGAGTGGGG - Intronic
1008186173 6:48393808-48393830 GCTTTGAAGGAGAGTGAGTGAGG + Intergenic
1009712529 6:67344175-67344197 GGGGAGAAGGAGGGGGAGTGAGG - Intergenic
1009778210 6:68233702-68233724 GAGGAGAAGGACAGAGAGTGAGG - Intergenic
1010236987 6:73583267-73583289 GTCCACAAAGGGAGTGAGTGTGG - Intergenic
1010366493 6:75058163-75058185 TGGCAGCAGGAGAGAGAGTGAGG + Intergenic
1010542238 6:77106068-77106090 GTGCTGAAGGATATTGGGTGTGG + Intergenic
1010646654 6:78397146-78397168 GTGTAGGCAGAGAGTGAGTGTGG - Intergenic
1012907912 6:105089485-105089507 GAGCAGGATGAGAGTGAGAGTGG - Intergenic
1013729754 6:113151189-113151211 GGGCAGAAGGAGAGAGAAGGTGG + Intergenic
1015101794 6:129490367-129490389 GTGGTGATGGAGAATGAGTGTGG - Intronic
1015322806 6:131894871-131894893 GCAAAGAAGGAGAGTGATTGTGG - Exonic
1016480628 6:144477014-144477036 GTGCAGAAAGAGATTGAGATAGG + Intronic
1016643534 6:146378187-146378209 GTGCAGAAGGAAAATGTGGGGGG + Intronic
1018064029 6:160113376-160113398 GTAGAGAAGGCGAGTTAGTGAGG - Intronic
1018385638 6:163300477-163300499 CTGCAGGAAGAGAGTGAGGGCGG - Intronic
1018411003 6:163548646-163548668 GTGCAGAGTGAGAGAGATTGAGG + Intronic
1018491611 6:164299460-164299482 GGGCAGCAGGAGAGAGAATGAGG - Intergenic
1018907045 6:168081503-168081525 GTCCAGAAGAAGAGAGAGTTGGG - Intronic
1019057870 6:169236047-169236069 GTGTGGATGGGGAGTGAGTGTGG - Intronic
1019057879 6:169236093-169236115 GTGTGGATGGGGAGTGAGTGTGG - Intronic
1019057889 6:169236137-169236159 GTGTGGATGGGGAGTGAGTGTGG - Intronic
1019057893 6:169236154-169236176 GTGTGGATGGGGAGTGAGTGTGG - Intronic
1019057906 6:169236215-169236237 GTGTGGATGGGGAGTGAGTGTGG - Intronic
1019057932 6:169236333-169236355 GTGTGGATGGGGAGTGAGTGTGG - Intronic
1019057953 6:169236419-169236441 GTGTGGATGGGGAGTGAGTGTGG - Intronic
1019057962 6:169236463-169236485 GTGTGGATGGGGAGTGAGTGTGG - Intronic
1019057966 6:169236480-169236502 GTGAATGTGGAGAGTGAGTGTGG - Intronic
1019057981 6:169236575-169236597 GTGTGGATGGGGAGTGAGTGTGG - Intronic
1019058008 6:169236710-169236732 GTGTGGATGGGGAGTGAGTGTGG - Intronic
1019058018 6:169236759-169236781 GTGTGGACGGGGAGTGAGTGTGG - Intronic
1019058028 6:169236808-169236830 GTGTGGACGGGGAGTGAGTGTGG - Intronic
1019058032 6:169236825-169236847 GTGTGGATGGGGAGTGAGTGTGG - Intronic
1019503775 7:1380329-1380351 ATGCAGGAGGAGAGAGAATGGGG + Intergenic
1019943980 7:4312209-4312231 GAGCAGAAGCAGAGGGAGGGAGG - Intergenic
1020927837 7:14355152-14355174 GTGGAGAAAGAGAGAGAGGGAGG - Intronic
1022091557 7:27110980-27111002 GGGGAGAAGGAGAATGAGTGAGG + Intronic
1022332811 7:29396678-29396700 ATGCAGCAGGAGAGTGGGAGGGG - Intronic
1023171550 7:37394523-37394545 CTGCAGAAGGAGAATAATTGGGG + Intronic
1023641638 7:42264885-42264907 GTGCAGGAGGAGAGTGAGAAAGG + Intergenic
1024207934 7:47179765-47179787 GTGCAGAAGGAGAAAGAGAAGGG + Intergenic
1024436793 7:49365884-49365906 GAGAAGAATGAGAGTGAGGGCGG - Intergenic
1024800105 7:53067259-53067281 GGGGAGAAGGAGAGAGAGAGAGG + Intergenic
1024850162 7:53704284-53704306 GTGCAGTAACAAAGTGAGTGAGG + Intergenic
1025264489 7:57443555-57443577 GTGCAGCATGAGAGGGGGTGGGG - Intergenic
1025622633 7:63188014-63188036 GTGCATATGGAGAGAGAGCGAGG - Intergenic
1025634715 7:63312551-63312573 GTGCAGCATGAGAGGGAGTGGGG + Intergenic
1025647981 7:63435619-63435641 GTGCAGCATGAGAGGGAGTGGGG - Intergenic
1025741292 7:64198491-64198513 GTGCAGCATGAGAGGGAGTATGG - Intronic
1026015387 7:66667450-66667472 GTGAGGGAGGAGGGTGAGTGAGG - Intronic
1026024303 7:66732520-66732542 TTGCAGAGGGTGAGTGACTGGGG - Intronic
1026512883 7:71041820-71041842 TTTCAGAATGAGAATGAGTGAGG + Intergenic
1026579543 7:71602591-71602613 CTGCAGAGGGAGAGAGAGAGAGG - Intronic
1027174779 7:75896409-75896431 CTGCAGAATGAGAAAGAGTGAGG + Intergenic
1027217904 7:76196023-76196045 GTTCAGAGGGAGAGTGACTGGGG + Intergenic
1027941779 7:84691477-84691499 GTGGAGAAGGAGGGAGAATGGGG - Intergenic
1029156413 7:98520848-98520870 GTGCTGGATGAGAGTGGGTGGGG + Intergenic
1029618096 7:101672527-101672549 GTCCAGAAGAAGAGGCAGTGAGG + Intergenic
1030361387 7:108598855-108598877 GTGCAGAGGAAGAGGGAGAGAGG + Intergenic
1033030552 7:137821864-137821886 GTGCTGAAGGTGAGGGTGTGAGG + Intronic
1033441942 7:141387927-141387949 GTGCAGGTGGGGAGAGAGTGAGG - Intronic
1033681599 7:143600838-143600860 GTGCAGAAGGAGAGAGACACGGG + Intergenic
1033703293 7:143860975-143860997 GTGCAGAAGGAGAGAGACACGGG - Intronic
1035658853 8:1331829-1331851 GAGCAGAGGGAGAGTGGCTGTGG + Intergenic
1036143032 8:6225704-6225726 GTGGGGAAGGAGAGGGAGGGAGG - Intergenic
1036754625 8:11464131-11464153 GTGCAGAAGGAAAGGGGGTGAGG + Intronic
1036772063 8:11585998-11586020 GAGCGGCAGGTGAGTGAGTGAGG + Intergenic
1037595801 8:20353209-20353231 GTACAGAAGGGGAGTGGGAGGGG - Intergenic
1038152725 8:24956837-24956859 GTACAGAAGGGAAATGAGTGAGG - Exonic
1038307897 8:26421173-26421195 GTCCAGAAGGAGGGTGGGAGCGG + Intronic
1038548042 8:28441220-28441242 GTGGAGGAGGAGAGGGAGTAGGG - Intronic
1038677302 8:29634992-29635014 GTCCAGAAGGAGAGAGAGAATGG + Intergenic
1038900995 8:31843705-31843727 GGGAAGAAGCAGAGTGACTGGGG - Intronic
1039441998 8:37601578-37601600 GGGCAGGAGGTGAGTGGGTGGGG - Intergenic
1039766466 8:40633506-40633528 GGGCAGAAGTACAGTTAGTGAGG + Intronic
1040003018 8:42595247-42595269 GTGGAGAAGGAGAGACCGTGGGG - Intergenic
1041280085 8:56199892-56199914 GAGCAAAAGGAGAGAGAATGGGG + Intronic
1041330051 8:56714457-56714479 GTGGGGAAGGACAGTGAGGGAGG - Intergenic
1041412620 8:57573545-57573567 TTTAAGAAGAAGAGTGAGTGGGG + Intergenic
1042711670 8:71724131-71724153 GTGCATAAGGAAAGGAAGTGTGG + Intergenic
1043097990 8:75999936-75999958 GAGCAGCAGGGTAGTGAGTGTGG - Intergenic
1043349050 8:79337403-79337425 GTACAGACAGAGAGTGAGAGTGG - Intergenic
1043924968 8:86026470-86026492 GTGCAGAAGGAGAGTGAGTGGGG - Intronic
1044526884 8:93262278-93262300 GAGCAGAAGGAGAGGGGGAGAGG + Intergenic
1045640496 8:104245045-104245067 GCTCAGAAGGAAAGTGAGTGAGG + Exonic
1047376716 8:124305635-124305657 GTACAGAAGGACATAGAGTGTGG + Intergenic
1048316977 8:133369839-133369861 GAGCAGAAGGAGAGGAAGAGAGG + Intergenic
1048317697 8:133374527-133374549 GAGCAGAAGGAGAGTGAGAGCGG - Intergenic
1048317703 8:133374578-133374600 GAGCAGAAGGAGAGTGAGAGCGG - Intergenic
1048941464 8:139404138-139404160 GTGCAGAAGCAGAGTGATGTGGG + Intergenic
1049503261 8:142979776-142979798 GTGCAGAGGGAGAGAGCCTGAGG + Intergenic
1049994080 9:1018222-1018244 GTGGAGTAGGAGAGTGGATGAGG - Intergenic
1050185633 9:2969901-2969923 ATGCTGGAGCAGAGTGAGTGAGG + Intergenic
1050295929 9:4205249-4205271 GTACATAAGGAGAGAGAGAGAGG - Intronic
1050301804 9:4266217-4266239 GTTAAGAAGCAGGGTGAGTGCGG - Intronic
1050405926 9:5308746-5308768 TTGCAGGAGCAGAGTGAGGGAGG - Intergenic
1050923363 9:11233941-11233963 GTGGAGAAGGAGGAGGAGTGGGG + Intergenic
1052192387 9:25675109-25675131 GTCCAAAAAGAGAGTCAGTGAGG - Intergenic
1052337175 9:27331825-27331847 GAGAAAAAGGAGACTGAGTGTGG + Intronic
1052778258 9:32754854-32754876 GTGGAGGAGGAGAGTGAGGTGGG - Intergenic
1053143571 9:35697275-35697297 GGGCAGTAGGAGAGACAGTGGGG - Exonic
1053518711 9:38754701-38754723 GTGCAGACTGAGAGGGACTGTGG + Intergenic
1053576672 9:39361712-39361734 GTGCTGAAGGGGACTGACTGGGG - Exonic
1055088565 9:72339042-72339064 GTGCAGAAGTAGAGGAACTGGGG + Intergenic
1055694596 9:78870277-78870299 TCACAGAAGGAGAGAGAGTGGGG + Intergenic
1057242782 9:93426873-93426895 GTGCAGGAGGAGAGTGAGGATGG + Intergenic
1057557562 9:96100010-96100032 GTGGAGAGGAAGAGGGAGTGAGG + Intergenic
1057734076 9:97637064-97637086 GTGCTGGAGCAGAGTGAGTGAGG + Intronic
1058626566 9:106939538-106939560 GTGCAAAGGGTGAATGAGTGGGG + Intronic
1058637321 9:107049276-107049298 GTGCAGGAGGAGGGAGAGGGAGG - Intergenic
1058657432 9:107236307-107236329 GTCCAGAAGGTGAGTGTCTGAGG - Intergenic
1059302796 9:113329044-113329066 GAGCAGAGAGGGAGTGAGTGAGG - Intronic
1059820776 9:117969796-117969818 GTGGAGAGGGAGAGGGAGAGAGG - Intergenic
1059860508 9:118455522-118455544 GAGCAGAAAGAGAGAGAGAGAGG + Intergenic
1060056787 9:120420990-120421012 TTGCAGAAGGAGTTGGAGTGAGG - Intronic
1060943438 9:127556367-127556389 GTGCAGAATGTGTGTGTGTGTGG - Intronic
1061400530 9:130365845-130365867 GAGCAGAGAGAGAGTTAGTGGGG - Intronic
1062240400 9:135534542-135534564 GAGCAGGAGGAGAGTGCGGGCGG - Intergenic
1062480944 9:136751054-136751076 GGGAAGAAGGAGAGAGAGAGAGG + Intergenic
1062491776 9:136808314-136808336 GTGCAGTACAACAGTGAGTGCGG + Exonic
1062616915 9:137401454-137401476 GTGCAGAAGGGAAATGGGTGGGG - Intronic
1203638134 Un_KI270750v1:133154-133176 GTGCAGGAAGACAGGGAGTGAGG - Intergenic
1185431516 X:14135-14157 GAGCAGACGGAGAGTGACGGAGG + Intergenic
1185440841 X:226854-226876 GAGCAGACGGAGAGTGACGGAGG + Intergenic
1185442130 X:231972-231994 GAGCAGACGGAGAGTGACGGAGG + Intergenic
1185836959 X:3353602-3353624 GAGCAGCAGGCCAGTGAGTGAGG - Intergenic
1186508383 X:10111741-10111763 GTGCAGAGAGAGAGTGAGGTTGG + Intronic
1187557818 X:20368940-20368962 GTGAAGAAGCAGAAAGAGTGCGG - Intergenic
1188606892 X:32042395-32042417 GGCAAGAAGGAGAATGAGTGAGG + Intronic
1188666702 X:32831581-32831603 GAGCAGAAGGAGAGAGAGAAGGG + Intronic
1190418205 X:50201725-50201747 GTACCGAAGGACATTGAGTGGGG + Intergenic
1190505441 X:51120474-51120496 GTGGAGAGGGAGAGGGAGAGGGG + Intergenic
1191713879 X:64180569-64180591 TGGCTGAAGTAGAGTGAGTGAGG - Intergenic
1191927057 X:66324735-66324757 GTGGCGAAGGAGTGTGGGTGTGG + Intergenic
1192573066 X:72222061-72222083 GTGGAGAAGGAGGAGGAGTGGGG - Intronic
1193275654 X:79584299-79584321 GGGTAGAAGGAGGGAGAGTGAGG - Intergenic
1194737214 X:97526803-97526825 AAGCAGAAGCAGAGTGGGTGTGG - Intronic
1195104189 X:101587274-101587296 GTTCAGAATAGGAGTGAGTGGGG - Intergenic
1195658786 X:107358661-107358683 GTGAAGAAGGAGAGGGAGGGAGG + Intergenic
1196002077 X:110796359-110796381 GTGCCGGAGGAGAGCGGGTGTGG - Intergenic
1196071198 X:111524468-111524490 TTGAAGAAGCACAGTGAGTGAGG + Intergenic
1196108256 X:111918852-111918874 GGGCTGAAGTAGAGTGAATGTGG + Intronic
1196267904 X:113674442-113674464 GTGCTGAAGGACAATGTGTGGGG + Intergenic
1196601297 X:117604452-117604474 GAGCAGAAAGAGAGAGAGGGGGG - Intergenic
1197432139 X:126379030-126379052 CTGCAGGAGGTGAGTGTGTGTGG + Intergenic
1197865097 X:131009153-131009175 GTGGAGCAGGAGAGAGAGAGAGG - Intergenic
1198084068 X:133266234-133266256 GTGCAGATGAGGAGTGAGGGAGG + Intergenic
1198479360 X:137026968-137026990 CAGCAGAGGGAGAGGGAGTGAGG + Intergenic
1199854826 X:151751759-151751781 GTGGAGGAGGAGAGTGGGTGTGG + Intergenic
1201143446 Y:11047410-11047432 GAGCATAAGGAGAGGGAGGGAGG + Intergenic
1201239610 Y:11946134-11946156 GAGCAGCAGGGCAGTGAGTGAGG + Intergenic
1201948157 Y:19535208-19535230 GTGGAGAGGGAGAGGGAGAGGGG - Intergenic