ID: 1043925104

View in Genome Browser
Species Human (GRCh38)
Location 8:86027878-86027900
Sequence GGATGAGACAAGTAGCAGTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043925104_1043925105 -7 Left 1043925104 8:86027878-86027900 CCGTACTGCTACTTGTCTCATCC 0: 1
1: 0
2: 0
3: 12
4: 139
Right 1043925105 8:86027894-86027916 CTCATCCCAGAACTCTGCTGAGG No data
1043925104_1043925108 7 Left 1043925104 8:86027878-86027900 CCGTACTGCTACTTGTCTCATCC 0: 1
1: 0
2: 0
3: 12
4: 139
Right 1043925108 8:86027908-86027930 CTGCTGAGGAACCACAACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043925104 Original CRISPR GGATGAGACAAGTAGCAGTA CGG (reversed) Intronic
904896576 1:33822536-33822558 GTAAGAGACAAGTAGGGGTAGGG - Intronic
907632695 1:56099234-56099256 GGTTGGGAAAAGTAGCAGTTGGG - Intergenic
909345231 1:74577348-74577370 GGTTGACACAAGTGGCAGTAAGG - Intronic
909360465 1:74753274-74753296 GAATGAGGAAAGAAGCAGTATGG - Intronic
909922155 1:81395482-81395504 TGAAGAGACAACTAGCAGAATGG - Intronic
911320492 1:96408385-96408407 GCATGAAACTAGTTGCAGTATGG + Intergenic
915927215 1:160031901-160031923 GCTGGAGACAGGTAGCAGTACGG - Exonic
916658235 1:166897129-166897151 GGAAAATACAACTAGCAGTAAGG + Intergenic
916704118 1:167329217-167329239 GGAAGAAACAGGTAGCAGTTTGG - Intronic
1066310137 10:34187930-34187952 GGATGGGACAACTAGCTGTCTGG + Intronic
1070692662 10:78539161-78539183 GGATGAGACATCTGGCAGTTTGG - Intergenic
1072786120 10:98283876-98283898 GGATGACACACGTAGGAGAATGG - Intergenic
1073280092 10:102347603-102347625 GCATGAGAAAAGGAGCAGGAAGG + Intronic
1074125244 10:110523995-110524017 GGATGAGTCAAGTATCACCATGG + Intergenic
1074563453 10:114554744-114554766 GGATAATAAAAGTAGCAATAGGG + Intronic
1080368756 11:31609584-31609606 CGATGAGACAAGTAGTCATATGG + Intronic
1084488366 11:69464091-69464113 GGCTGAGACAAATTGCAGAATGG - Intergenic
1084565470 11:69926118-69926140 GGATGAGATAAGCAGCATTCTGG - Intergenic
1084587141 11:70068851-70068873 GGCTGTGACAGGCAGCAGTAGGG + Intergenic
1086446331 11:86874820-86874842 GGATGATACAAGTGGCCGAAGGG + Intronic
1090809460 11:130223853-130223875 GGATGAAGCTAGTAGCAGCAGGG + Intergenic
1093533055 12:20189699-20189721 TGATGAGAAAAGTAGAAATAAGG + Intergenic
1096255582 12:50060004-50060026 GGAGGAGACAAGGAGCAGGCTGG + Intronic
1098841996 12:75488099-75488121 GGATAAAACAGGTTGCAGTAAGG - Intronic
1100145367 12:91671161-91671183 GGATATGCCAAGTAACAGTAGGG + Intergenic
1103171318 12:118822585-118822607 GGATGAGAGAAATAGCAATTAGG + Intergenic
1103608453 12:122106042-122106064 GGCTGGGAAAAGTAGCAGCAAGG + Intronic
1104731739 12:131108955-131108977 GGATGAGACAGGTGGAAGTGGGG + Intronic
1107783823 13:43934293-43934315 GGATGAGACAGGCAACAGGATGG + Intergenic
1107814052 13:44228462-44228484 GGATAAGAGAGGTAGCAGTGAGG - Intergenic
1108835518 13:54542101-54542123 GGATGAGATAAGCAGAAGGATGG - Intergenic
1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG + Intergenic
1109247704 13:59976703-59976725 AGATGAGACAAGCAGGAGGAGGG - Intronic
1109353143 13:61208496-61208518 GGATGAGTCAGGTAGCGCTATGG - Intergenic
1109987210 13:70003784-70003806 GAATGAGATAATTAGGAGTAAGG + Intronic
1112052391 13:95655892-95655914 AAAGGAGACAAGTAGCTGTAAGG + Intergenic
1116054756 14:39849441-39849463 GGGTGAGACAACTAGAAGTGGGG - Intergenic
1118229798 14:63937318-63937340 GGATGGGAGAATTAACAGTATGG + Intronic
1118509777 14:66459164-66459186 GGATGAGATCAGAGGCAGTAGGG - Intergenic
1124091986 15:26614033-26614055 GGAGGAGGAAAGTAGCAGAAAGG + Intronic
1125141310 15:36410696-36410718 GGATGAGAAAAGGAGCAGCTTGG + Intergenic
1133620639 16:7522987-7523009 GGATGAGGCAAGGAGGAGGAGGG - Intronic
1138356286 16:56383636-56383658 GGATGAGAGAAGTGGCTGAATGG - Intronic
1141591773 16:85073816-85073838 GGATGAGCCAAGGACCAGGAGGG - Intronic
1143355941 17:6328584-6328606 GTAGGAGACACTTAGCAGTATGG + Intergenic
1146064112 17:29622029-29622051 GGATGAAAACAGTAGCAGAAAGG - Intronic
1146805477 17:35861762-35861784 AGGTGTGACAAGTAGGAGTAGGG - Intronic
1149128892 17:53271166-53271188 TGATGTGACAAGTAGGAGAATGG - Intergenic
1151038521 17:70829583-70829605 GGATGAGACAGGTAGCTTTCTGG - Intergenic
1153658465 18:7305817-7305839 GGCTGAGACACGTAGAAGTTTGG - Intergenic
1153934984 18:9913674-9913696 GGAAGGGACAAGTAGTAGTAGGG - Intergenic
1154062891 18:11080113-11080135 AGATGAGAGAGGTAGCAGTGTGG - Intronic
1155040036 18:22057275-22057297 GGAAGAGACAATGAGCAGTGAGG - Intergenic
1161899881 19:7110453-7110475 AGATGGGAGAAATAGCAGTATGG - Intergenic
1162374975 19:10299643-10299665 GGAAGAGATAAGTAGGAGGAAGG - Intergenic
1163215632 19:15874914-15874936 GGATAAGACAGTTATCAGTAAGG + Intergenic
1165333476 19:35154205-35154227 GGATGAGACAAGGAGGTGCAGGG - Exonic
928479004 2:31661931-31661953 GGATGAGATTAGTAGAAGTTTGG - Intergenic
928517308 2:32055751-32055773 GGATGAGAGAAGTAACAATTGGG - Intergenic
931572785 2:63687385-63687407 TGAAGAGACAACTAGCAGAATGG + Intronic
935319708 2:101874100-101874122 GGATGAGACCAGAAGCCATAAGG + Exonic
940515371 2:154677863-154677885 AGATCAGGAAAGTAGCAGTAAGG - Intergenic
941019934 2:160397159-160397181 GGATGACTCAAGCAGTAGTAAGG - Intronic
942308696 2:174633892-174633914 GGAGTAGAGAAGCAGCAGTAGGG - Intronic
943717632 2:191169746-191169768 GGAAGAGACAAGTCACAGTATGG + Intergenic
945891395 2:215435292-215435314 GAAGGAAATAAGTAGCAGTAAGG + Intronic
946998044 2:225418372-225418394 GGATGAGAGAGGTCTCAGTAAGG + Intronic
1169989255 20:11482402-11482424 GGATGTGATATGTAGAAGTAAGG + Intergenic
1172828510 20:37811498-37811520 GAATGAGACAAGCAGCTGGAGGG - Intronic
1173882122 20:46423442-46423464 GGATGAGACAAGAGACAGGAAGG - Intronic
1174680112 20:52398503-52398525 GAATGATAAAAGCAGCAGTATGG + Intergenic
1179108194 21:38422288-38422310 GGCTGAAACAAGTAACAGGAGGG + Intronic
1179210317 21:39319241-39319263 GGCAGGGACAAGTAGCATTAAGG - Intronic
1184037532 22:41925842-41925864 GGAAGAGACAGGTTGCAGGAAGG - Intronic
949556903 3:5161971-5161993 GGCAGAGACAAGTAGCTTTAAGG + Intronic
950118698 3:10467840-10467862 GGTGGAGACAAGGAGCAGCAGGG - Intronic
951514031 3:23537987-23538009 GAATGAGACATGCAGCAGCAAGG - Intronic
951797744 3:26560021-26560043 AGATGAGAAAAGTGTCAGTACGG + Intergenic
951874491 3:27407158-27407180 GGAAAAGACAGGTAACAGTATGG - Intronic
952544788 3:34407208-34407230 GGATGGGACAACTTGCAGTGGGG - Intergenic
955131670 3:56175557-56175579 GAATGAGACAAGCAGCGCTAGGG - Intronic
960871475 3:122254142-122254164 GGATGAGACAGCTAGGAGTTTGG - Exonic
960888164 3:122417864-122417886 GGAAGAGAAAAGCAGCAGCAGGG - Intergenic
962204065 3:133420839-133420861 GGGTGAGACAGGTAGGAGTGTGG - Intronic
964718452 3:159747514-159747536 GGATGAGACAAATATAGGTAGGG + Intronic
965903653 3:173675144-173675166 GGAAGAGAGAAGCAGCAGAAAGG + Intronic
966882930 3:184360131-184360153 GGATGAGAGAGGAAGAAGTACGG + Intronic
967334925 3:188334022-188334044 GGTGGAGAAAAGTAGCAGGAGGG - Intronic
968492191 4:895935-895957 GGATGAGTCGAGTAGCAGTTGGG - Intronic
968758397 4:2428364-2428386 GGGTGAGAGACGTAGCAGCACGG - Intronic
969129853 4:4983359-4983381 AGCTGAGACAAGCAGCAGGATGG + Intergenic
969965628 4:10992388-10992410 TGATTAGACAAGGAGCAGTGGGG + Intergenic
971960796 4:33484641-33484663 GGATGAAATAAGTAACAGTATGG + Intergenic
974755209 4:66196774-66196796 TGAAGAGACAACTAGCAGGATGG + Intergenic
975445567 4:74460558-74460580 GGATACAACAAGTAGCAATAGGG - Intergenic
978295065 4:107195453-107195475 GGATGAGAAAAACAGGAGTAAGG + Intronic
978848604 4:113306311-113306333 GGATTAGATAAGGAACAGTATGG + Intronic
981457882 4:144977418-144977440 GGAGGAGAAAAGGGGCAGTAAGG - Intronic
985087960 4:186333558-186333580 GGATGCGCCCAGTAGCAGAATGG - Intergenic
986371134 5:7081351-7081373 GAATGAGAAAAGTAGTAGTTGGG - Intergenic
987502365 5:18730156-18730178 GAATTAGAGAAATAGCAGTAAGG + Intergenic
994066033 5:95543652-95543674 GAATTTGACCAGTAGCAGTATGG - Intronic
994347343 5:98701886-98701908 GGATCAAACAAGTAGAAGAAAGG + Intergenic
994833818 5:104822067-104822089 GGATGTTAAAAGTAGCAATATGG + Intergenic
995705538 5:114985492-114985514 GGATGAGGGAAGCAGCAGCATGG - Intergenic
996824789 5:127669913-127669935 GGATGAGACAAATTGGAGTAGGG + Intergenic
997040862 5:130252011-130252033 CCATGGGACAAGTAGAAGTAAGG - Intergenic
1007700369 6:43762888-43762910 AGATGGGACAGGTAGCAGGAAGG - Intergenic
1008628217 6:53338283-53338305 GGATGTGACAAGTGACAGTAAGG - Intronic
1009344667 6:62598256-62598278 GTTAGAAACAAGTAGCAGTAGGG + Intergenic
1009553907 6:65137289-65137311 GGATCAGAGAAGAAGCAGTGCGG + Intronic
1010456098 6:76057353-76057375 TGATGAGGCATGTAGCAGTGGGG + Intronic
1010748530 6:79591862-79591884 GGATTAGACAGGTATCAGCAGGG - Intergenic
1011247701 6:85336942-85336964 GTATGAGACATGTATCAGGAAGG + Intergenic
1019448733 7:1084924-1084946 GGATGGGACAGGGAGCAGGAAGG + Intronic
1020743084 7:12046775-12046797 TGATGTGACAAGAAGCAGTCAGG + Intergenic
1022157581 7:27675718-27675740 GGATGAGAAAAGTCACAGTTGGG - Intergenic
1026453593 7:70551495-70551517 GCATCAGACAAGTTTCAGTAGGG + Intronic
1028907878 7:96175216-96175238 AGATGAGACAATGAGCAGAATGG + Intronic
1030372798 7:108719449-108719471 GGATGAGAGAAGTGGCAGTGGGG - Intergenic
1032285725 7:130537224-130537246 GGATGAGAAAAGAATCAGGAAGG + Intronic
1032286488 7:130541650-130541672 GGATGAGAAAAGAATCAGGAAGG + Intronic
1033734794 7:144211329-144211351 AGAGGAGAAAAGTAGAAGTAGGG - Intergenic
1033748261 7:144339640-144339662 AGAGGAGAAAAGTAGAAGTAGGG + Intergenic
1035405358 7:158593469-158593491 GGTTGAGACAAATACCAGTCTGG + Intergenic
1036443232 8:8799780-8799802 GGATGAGACATTTAGAAATACGG - Intronic
1042834194 8:73063253-73063275 GGATGAGAGGAGTGGCAGTGAGG + Intergenic
1043925104 8:86027878-86027900 GGATGAGACAAGTAGCAGTACGG - Intronic
1045682204 8:104674376-104674398 GGAAGACACAAGTGCCAGTAAGG - Intronic
1046775902 8:118163428-118163450 GGAAGAGAAAAGTAGCAGGAGGG + Intergenic
1047204172 8:122790150-122790172 GGATGAGTCTAGTAGCAACATGG + Intronic
1047833139 8:128657896-128657918 GACTGAGAGAGGTAGCAGTAAGG + Intergenic
1049919309 9:348311-348333 GGTTGAGGCAGGTAGGAGTAAGG + Intronic
1051154031 9:14120531-14120553 GGATGAGAAAAGTAGCTCGATGG + Exonic
1052840933 9:33290360-33290382 GGAGGAGACTAGTAGCTGGATGG - Intergenic
1054733718 9:68728676-68728698 AGCTGAGAGAAGTAGCAGAAGGG + Intronic
1054827274 9:69585849-69585871 GGATGAGATAAGCAGGAGAAAGG - Intronic
1056027302 9:82512213-82512235 GGATGTGACAAGTATCTTTAAGG + Intergenic
1057842034 9:98494268-98494290 GGAGGAGAAAATTAGCAGAAAGG + Intronic
1061612744 9:131758967-131758989 GGATGAGCCAGGTAGAGGTAGGG + Intergenic
1185531575 X:823386-823408 GGCTGAGAAAAGTAGCAGGAAGG - Intergenic
1186801898 X:13101358-13101380 GGAAGAGGCAAGGAGCAGCATGG - Intergenic
1188253616 X:27930875-27930897 GGAGGAGACTGATAGCAGTAAGG - Intergenic
1188415692 X:29931087-29931109 GGATGAGGCAAGTAATGGTAGGG + Intronic
1190602597 X:52108072-52108094 GGATGACACAAGTACCTCTATGG + Intergenic
1193464991 X:81837326-81837348 ATATGAACCAAGTAGCAGTATGG + Intergenic
1196100516 X:111842776-111842798 GGATGAGAGAGGTAGGAGAAAGG + Intronic
1196278182 X:113793037-113793059 GGAGCAAACAAGTAGCAGTATGG + Intergenic
1196279820 X:113811120-113811142 GGAGGAAACAAGTAGCTGCAAGG + Intergenic
1197877994 X:131132171-131132193 GGATGAGAGAAATAGCAGGAGGG - Intergenic
1198720400 X:139612050-139612072 GGATTAGGAAAGTGGCAGTAAGG + Intronic
1198850008 X:140956128-140956150 GCAAAAGACAAGTAGCAGTCAGG + Intergenic