ID: 1043928711

View in Genome Browser
Species Human (GRCh38)
Location 8:86066525-86066547
Sequence TAGCTAAGGATGACAGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043928707_1043928711 6 Left 1043928707 8:86066496-86066518 CCTGGACTTCATTTTAATAAAAC 0: 1
1: 0
2: 1
3: 35
4: 359
Right 1043928711 8:86066525-86066547 TAGCTAAGGATGACAGAGAATGG No data
1043928706_1043928711 14 Left 1043928706 8:86066488-86066510 CCACTGTGCCTGGACTTCATTTT 0: 2
1: 10
2: 145
3: 1267
4: 5720
Right 1043928711 8:86066525-86066547 TAGCTAAGGATGACAGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043928711 Original CRISPR TAGCTAAGGATGACAGAGAA TGG Intronic
No off target data available for this crispr