ID: 1043933972

View in Genome Browser
Species Human (GRCh38)
Location 8:86121778-86121800
Sequence CAGGAAGTTACTTCATTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043933972 Original CRISPR CAGGAAGTTACTTCATTTGA TGG (reversed) Intronic
901329826 1:8397722-8397744 CAGGAACTTACTGCATATGGGGG - Intronic
901864174 1:12093197-12093219 CAGGATGTGACTTTATTTGGAGG - Intronic
906659909 1:47574786-47574808 AAGGAAGCTACCCCATTTGATGG - Intergenic
906684019 1:47751322-47751344 CAGGAAGTGATTTCATTCAAAGG - Intergenic
916515088 1:165509007-165509029 TAGAAAGTGACTTCATCTGAAGG + Intergenic
916676845 1:167071148-167071170 CACCAAGTTACTTCATTTGAAGG + Intronic
918691227 1:187482015-187482037 CAGGAAGTCATTTAATTTGAAGG - Intergenic
920016404 1:202913429-202913451 CACAAAGTTCATTCATTTGAGGG + Intronic
920713483 1:208317423-208317445 CAGGAAGTTTATCTATTTGACGG + Intergenic
920861427 1:209711049-209711071 CAGCAAGTGACTTCATCTGTTGG - Intronic
924074557 1:240319883-240319905 CAGGAAGATGTTTCATTTGCGGG - Intronic
1063176297 10:3553745-3553767 GTGGAAGTAACTCCATTTGATGG + Intergenic
1065008971 10:21404693-21404715 CAGGAAGGCAGGTCATTTGAAGG + Intergenic
1065193767 10:23240815-23240837 TGGGAAGTCACTTCATTAGATGG - Intergenic
1065600504 10:27363124-27363146 CATGAAGCTACTTCAGGTGAAGG + Intergenic
1066153770 10:32652941-32652963 AAGGAAGTTACTCAATCTGATGG - Intronic
1067739571 10:48884295-48884317 CAGGAAGTTACTGCATATAAAGG - Intronic
1073576657 10:104631518-104631540 GAGGAAGATACTTCTTTTGGGGG + Intergenic
1073676113 10:105648587-105648609 CAGAAAGCTATTTAATTTGATGG + Intergenic
1076651220 10:131989675-131989697 CAGGAAGTCACTTCTATTAAAGG - Intergenic
1079164256 11:18023616-18023638 CAGCAAGCTACTTCTTTTGCTGG - Intronic
1079318885 11:19433355-19433377 GAGGAAATTTCTGCATTTGATGG + Intronic
1079432609 11:20408474-20408496 TTGGAATTTACTTAATTTGAAGG - Intronic
1080980797 11:37403220-37403242 CAGGAAGTGAAATAATTTGAAGG + Intergenic
1081452041 11:43180439-43180461 CAGAAAGTGAATTCATTGGAAGG + Intergenic
1082931879 11:58617043-58617065 CAGTAACATACTTCTTTTGAAGG - Intronic
1083753358 11:64775552-64775574 CAGCATGTTACTACTTTTGAGGG - Intronic
1087822476 11:102728046-102728068 ATGGAAGTTACTTCACTTGGTGG - Intergenic
1091058031 11:132437091-132437113 CAGGAAAATACTTCATCAGATGG - Intronic
1091314092 11:134598567-134598589 CAGGAAGTTGGGCCATTTGAGGG + Intergenic
1092720044 12:11432556-11432578 CAGGAGGTATCCTCATTTGATGG - Intronic
1098744766 12:74221741-74221763 CAGTAAGATTCTTCATTTGCTGG - Intergenic
1099243186 12:80162769-80162791 CAGAAAGTAACATTATTTGAAGG - Intergenic
1099496933 12:83360249-83360271 AATGAAGTTACTTCATTACAAGG + Intergenic
1107121883 13:36804877-36804899 CAGGAAGACATTTCTTTTGATGG + Intergenic
1107297410 13:38925348-38925370 CAGGATTTTATTTCATTTTATGG - Intergenic
1107660112 13:42630537-42630559 CAGGCAGTTGCTTTCTTTGATGG - Intergenic
1110097204 13:71542424-71542446 CAGGCTGTTTCTTCATTTCATGG + Intronic
1111255811 13:85666863-85666885 CAGCAAATTTATTCATTTGAGGG + Intergenic
1112881141 13:104107897-104107919 CAGGAACATATTGCATTTGAGGG - Intergenic
1112953571 13:105032548-105032570 CAGGAGGTTTCTTTATTTGGAGG + Intergenic
1112968014 13:105223272-105223294 CAGGAAATTATGTCATTTGATGG + Intergenic
1113278139 13:108757834-108757856 CATGTAGCTACTTCATATGAGGG + Intronic
1114370661 14:22084300-22084322 CATGAAGTGACTCCATCTGACGG + Intergenic
1115799269 14:36973819-36973841 CAGCAAGATAATTCATTTAAAGG + Intronic
1116445670 14:45007364-45007386 TAGGAAGGGAATTCATTTGAAGG + Intronic
1116595095 14:46831679-46831701 AGAGAACTTACTTCATTTGAGGG + Intergenic
1116833531 14:49746385-49746407 TAGGACCTTACTACATTTGAGGG + Intronic
1116896416 14:50319587-50319609 CAGGAAGTTACTTAATATCAGGG + Intronic
1117846579 14:59918430-59918452 CACTAAGTTTCTTAATTTGAGGG - Intergenic
1118313408 14:64708863-64708885 CAGGAAGTTCCTTCATCACAGGG - Intronic
1119009933 14:70974120-70974142 CAGGATGTTATTTCTTTTTATGG + Intronic
1121900586 14:97690108-97690130 CAGGGTGTTGCTTCCTTTGACGG + Intergenic
1124204462 15:27705054-27705076 CAGGAAGTTAGTTCATGTTCTGG - Intergenic
1128835723 15:70807674-70807696 CAGGAAATTCCTACATATGAAGG - Intergenic
1130000324 15:80040721-80040743 CAGGCATTTATTTCATTTGTAGG + Intergenic
1135803965 16:25525260-25525282 CAGGAATTTTCTTCAGCTGAAGG + Intergenic
1137041356 16:35615799-35615821 CAGGAATTCACTTGATTTTATGG + Intergenic
1138725427 16:59133069-59133091 CAGGAAGTTGCTTCAGTTAGAGG + Intergenic
1143290661 17:5825572-5825594 AAGGAAGTCAGTTCATGTGAGGG - Intronic
1146437624 17:32865881-32865903 CAGTAAGTGACTTCAGTTGATGG - Intronic
1147416964 17:40299053-40299075 CAGGAAGTAACTTCAGGTAAAGG + Intronic
1151873962 17:76855995-76856017 CGTGAAGTTACTTCATTTTTTGG + Intergenic
1153000280 18:448888-448910 TAAAAAGTTACTTCAGTTGAAGG + Intronic
1153470476 18:5439041-5439063 TGGTAAGTTACTGCATTTGAAGG - Intronic
1155176393 18:23304963-23304985 CAGAAAGCTAATTCATTGGATGG - Intronic
1156568078 18:38218998-38219020 CAGGAAGTTTTTTGACTTGATGG + Intergenic
1157285933 18:46377461-46377483 CAGGAAGGTGCTTCATAGGAGGG + Intronic
1159075184 18:63673318-63673340 CAGGATGTTATTTCTTTTTAAGG - Intronic
925246938 2:2392015-2392037 CAGTAAGTCAGTTCATTAGAAGG - Intergenic
925332515 2:3069840-3069862 CAGGAACTCAGTTCATTTCATGG - Intergenic
925489308 2:4374687-4374709 CAAGAACTTTCTTCATATGATGG + Intergenic
930760004 2:55023393-55023415 CAGTATGTTAGTTCATTTGCTGG - Intronic
937629144 2:124079754-124079776 AAGGAATTTATTTCATATGATGG + Intronic
938660924 2:133486479-133486501 CAAGAAGGTACTTCAGGTGATGG - Intronic
939007035 2:136801146-136801168 CTGCAAGTTACATCATTTGTCGG - Intronic
939784508 2:146493529-146493551 CAGGGACTTTCTTCATTTGGTGG + Intergenic
939913199 2:148007830-148007852 AAAGAAGTAACTTCATATGAAGG + Intronic
940021735 2:149163109-149163131 CTGTAAGTTACTTTATTTTATGG + Intronic
942743488 2:179206271-179206293 CAGCAAGCCACTTCTTTTGAAGG - Intronic
943313536 2:186357138-186357160 CCTGAAGTTACTTCATTTTCTGG + Intergenic
948513594 2:238489010-238489032 GAGGAAGTTGCTTGCTTTGAAGG + Intergenic
1170807010 20:19640965-19640987 CAGGTGTTTGCTTCATTTGAAGG + Intronic
1173365182 20:42378744-42378766 CAGGAAGTTAAATAATTTGCAGG - Intronic
1177398916 21:20576403-20576425 CTGGGAGGTACTTCATTTGTGGG - Intergenic
1185323153 22:50211171-50211193 CAGGATTTTATTCCATTTGAAGG + Intronic
951970376 3:28438264-28438286 CTGGAAGTCACTTCAGCTGAAGG - Intronic
955748857 3:62167725-62167747 CAGCAAAACACTTCATTTGAGGG - Intronic
958102314 3:89028590-89028612 CAGGTTGCTACTTCATTTTAAGG + Intergenic
959503198 3:107130560-107130582 GAGGGAGTGACTGCATTTGAGGG + Intergenic
959798912 3:110466452-110466474 GAGTCAGTTACTTGATTTGAAGG + Intergenic
963342911 3:144058680-144058702 CAGCAAGTTACTTTATATGTAGG + Intergenic
963534162 3:146507240-146507262 CTGGAACTTACTTCATTTTCTGG + Intergenic
964040318 3:152253510-152253532 CAGGAGGTCACATGATTTGATGG - Intronic
965177835 3:165358878-165358900 AATGAAATTACTTCATTTGTTGG - Intergenic
965554338 3:170004175-170004197 GAGGAAATCACTTCATTTGAGGG + Intergenic
966690419 3:182735952-182735974 GAGTAAATTACTGCATTTGAAGG - Intergenic
968219591 3:196926527-196926549 CTTGAAGTTACTTCTTTAGAGGG + Intronic
969510629 4:7615616-7615638 GAGGAAGTTATTTCAGGTGATGG - Intronic
970725339 4:19037230-19037252 CAGAATGTTACTGCATTTGTAGG + Intergenic
972145065 4:36013650-36013672 CAGGAAATGACCTCATATGAAGG + Intronic
975920999 4:79388087-79388109 CATGAAGGTACTTATTTTGAGGG + Intergenic
976121551 4:81789021-81789043 TAATAAGTTACTTCATGTGAAGG + Intronic
977821260 4:101474798-101474820 CAAGAATTTAATACATTTGAAGG + Intronic
978255707 4:106690519-106690541 CACGAGCCTACTTCATTTGAAGG + Intergenic
978869716 4:113560847-113560869 CAGGAAGTTACTCCATACAAAGG + Intronic
978996624 4:115163879-115163901 CTGGAAGATAATACATTTGATGG + Intergenic
979939517 4:126742556-126742578 CAGGACGTTTCATTATTTGATGG + Intergenic
982885950 4:160783159-160783181 CAGCAAGTTACTTCTATAGAAGG + Intergenic
983461368 4:168028873-168028895 GAGGAAGTTAGTTCATCTCATGG + Intergenic
983717370 4:170799961-170799983 CAGGAAGTTACTCCAGGAGAAGG + Intergenic
984366573 4:178806442-178806464 CAGGAGGTAATTGCATTTGAAGG - Intergenic
985249131 4:188005558-188005580 CAGAATGTGACTTTATTTGAAGG - Intergenic
988173298 5:27687352-27687374 AAGAAAGCTACTTCATTTCAAGG - Intergenic
988191597 5:27944001-27944023 CAGGAATTAACTTCCTTTCATGG - Intergenic
988293871 5:29329624-29329646 CAGGACTTTACTCCATTTTATGG - Intergenic
988992853 5:36688654-36688676 CAGGAAGTTACTTTTTCGGAAGG - Intergenic
990080766 5:51911143-51911165 GAGGAATTTCCTTCATTTTATGG + Intergenic
992553235 5:77879307-77879329 AACCAAGCTACTTCATTTGAAGG - Intergenic
993281843 5:85935051-85935073 CAAGAAGTTTCATCATGTGAAGG + Intergenic
993687430 5:90956658-90956680 CATAAAGTACCTTCATTTGAAGG - Intronic
994762533 5:103874380-103874402 CAGAAAGTTAATCAATTTGAAGG + Intergenic
995838597 5:116422262-116422284 AGGGAAGGTACTTCATTGGATGG + Intergenic
996851374 5:127956945-127956967 CATGAAGTTCCTTCTGTTGATGG + Intergenic
998187989 5:139997722-139997744 CAGGAATTTGCTTCATTCTAGGG - Intronic
1000821662 5:165992185-165992207 CAGTAAGTAACTTGATTAGATGG + Intergenic
1002829965 6:811303-811325 CATGAAGTTTCTCCATTTCAAGG - Intergenic
1004417898 6:15441529-15441551 CAGAAATTTTCTTCATTTAAAGG - Intronic
1005707584 6:28470613-28470635 CAGAAAATTCCTTCATTTCAAGG - Intergenic
1006521558 6:34573917-34573939 CAGGAAGTAGCTCCATTTCATGG + Intergenic
1008766232 6:54918858-54918880 CGGGGAGTTACACCATTTGAGGG - Intronic
1010915173 6:81607649-81607671 CAGATAGTTACTTCATGTAAAGG + Intronic
1011673597 6:89708909-89708931 CAGGAAGTGAATTCATTGGTTGG - Intronic
1011995423 6:93581059-93581081 TAGGAAAATACTTCATTTTATGG - Intergenic
1014410969 6:121120154-121120176 CAGAAAGTCACTTCATTTTTTGG + Intronic
1014672856 6:124328788-124328810 AAGGAAGTTTCTTCATTCAATGG - Intronic
1015032955 6:128617881-128617903 CTGGAAGTCAATTCATTTGGGGG + Intergenic
1015369553 6:132435404-132435426 CAAGAGGTTATTTCAATTGAGGG + Intergenic
1015700964 6:136035627-136035649 GAGGAACCTACTTCATTTGAAGG - Intronic
1016096147 6:140040191-140040213 AAGGAATTAACTTCATTTTATGG + Intergenic
1017963517 6:159243907-159243929 CAGGAAGTGAACTCATTTGCTGG + Intronic
1020750290 7:12132454-12132476 TAGGGAGTTTCTTCCTTTGATGG - Intergenic
1021203111 7:17747981-17748003 TAAGAACTTCCTTCATTTGAAGG + Intergenic
1022638734 7:32161584-32161606 AAGGAAGTTCCTTCCTTTGAAGG - Intronic
1022844854 7:34199752-34199774 CAGGAAGATACTGCATCTCATGG + Intergenic
1023715483 7:43039568-43039590 CAGCAACTTCCTTCTTTTGATGG - Intergenic
1023749652 7:43359911-43359933 CATGAGTTTAGTTCATTTGAAGG - Intronic
1024967024 7:55032875-55032897 CAGGAATTTACTACCTTTGCAGG + Intronic
1026017984 7:66685894-66685916 CAGGTATTTCCTACATTTGAGGG - Intronic
1026026159 7:66745378-66745400 CAGGTATTTCCTACATTTGAGGG - Intronic
1029811887 7:103057715-103057737 CAAGAAGTTTCTTCTTTTGGGGG - Intronic
1031156033 7:118113566-118113588 GATGAAGTTATTTCATTTGAGGG + Intergenic
1031965759 7:128027223-128027245 AAAGAAGTTACATCATTAGATGG + Exonic
1032750973 7:134841409-134841431 CAGGAAGTCACATAATTTGTGGG - Intronic
1033726721 7:144126579-144126601 TAGAAAGCTACTTGATTTGAGGG - Intergenic
1034912792 7:155011317-155011339 CAGGAAGTTACTCCAGGTCATGG + Intergenic
1036447398 8:8833805-8833827 CAGTATGTTCATTCATTTGATGG - Intronic
1037383747 8:18315703-18315725 CAGGAAGCCACTTCTTTTGAAGG - Intergenic
1037546577 8:19929687-19929709 CAGGAAGAGACTTCATGTTAAGG - Intronic
1037657244 8:20895535-20895557 CAGTAAATTACTTCAGTTTATGG - Intergenic
1037797237 8:22006142-22006164 GAGGAAGTTACTACAGTGGAAGG + Exonic
1038044135 8:23751817-23751839 CAGGAAGTAATTTCATGAGAAGG - Intergenic
1038807471 8:30808454-30808476 TAGGAAGTTACATCGTATGATGG - Intronic
1043235680 8:77862565-77862587 CATAAGGTTACTTCAATTGAGGG + Intergenic
1043933972 8:86121778-86121800 CAGGAAGTTACTTCATTTGATGG - Intronic
1045894308 8:107195771-107195793 CAGAAAGTTGCTTCCCTTGATGG - Intergenic
1046185351 8:110707518-110707540 CAGAAAATAACTTCATTAGAAGG + Intergenic
1048482092 8:134807447-134807469 CAGAATTTTACTTCATTTGAGGG - Intergenic
1048773779 8:137923180-137923202 TAGGAAGTCACTGGATTTGATGG - Intergenic
1050039298 9:1471900-1471922 CATAAAGTTACTTCAGTTGAGGG - Intergenic
1051355975 9:16240014-16240036 AAGGAGGTTACTTCAAGTGAGGG - Intronic
1051388936 9:16542451-16542473 TAGGAAGTTTTTTCATTTGTTGG - Intronic
1052104901 9:24501476-24501498 CAGGAAGGTAGTTCATTCCAAGG - Intergenic
1052952203 9:34221665-34221687 TAGTAAATTACTTCCTTTGATGG - Intronic
1053392748 9:37747355-37747377 CAGGAAGTTCTTTCATTGCAAGG + Intronic
1055105904 9:72512686-72512708 CAGGAACCTTCTTCTTTTGATGG - Intergenic
1055670646 9:78602457-78602479 CAGGAAATTATTTCATTCGGGGG - Intergenic
1056226437 9:84500210-84500232 CATCAAGTAGCTTCATTTGATGG - Intergenic
1061605048 9:131703571-131703593 CAGCAAGTTACTTAATTTCTGGG - Intronic
1062677953 9:137759344-137759366 CAGGAAGTTACTTGGTTTTAAGG + Intronic
1187075943 X:15935085-15935107 GGGGAAGTTACCTCATTTCAAGG + Intergenic
1191042319 X:56096839-56096861 CAGTAATTTACTGAATTTGAGGG + Intergenic
1191075041 X:56443834-56443856 CAGTAAGATACTTCATGAGAAGG - Intergenic
1193568648 X:83113260-83113282 CAGGAAGTTACGTCTTTCAAGGG - Intergenic
1194175622 X:90643805-90643827 TAGGAAGTTGCTTCATGTGAGGG - Intergenic
1197322241 X:125046735-125046757 TGGGAAGTTAGTTCATTTGGGGG - Intergenic
1197811419 X:130447415-130447437 ATTGAATTTACTTCATTTGAAGG + Intergenic
1199489796 X:148385837-148385859 CAGGATGTGACTGTATTTGAAGG + Intergenic
1200243726 X:154511688-154511710 CAGGAAGTAACTTGTTTTGTAGG + Intronic
1200376310 X:155784143-155784165 CATGCAGTTAGTTTATTTGAGGG + Intergenic
1200522264 Y:4224763-4224785 AAGGAAGTTGCTTCATGTGAGGG - Intergenic
1200606696 Y:5272671-5272693 CATGAAATTCCTTCATTTTAAGG - Intronic