ID: 1043933972

View in Genome Browser
Species Human (GRCh38)
Location 8:86121778-86121800
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043933972 Original CRISPR CAGGAAGTTACTTCATTTGA TGG (reversed) Intronic