ID: 1043934239

View in Genome Browser
Species Human (GRCh38)
Location 8:86125146-86125168
Sequence GGTTGAGGATGTTAAGGTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043934235_1043934239 4 Left 1043934235 8:86125119-86125141 CCACATGTCAGCAAAATCAGCGT 0: 1
1: 0
2: 1
3: 4
4: 104
Right 1043934239 8:86125146-86125168 GGTTGAGGATGTTAAGGTAATGG No data
1043934234_1043934239 30 Left 1043934234 8:86125093-86125115 CCACTACTGTTGTTGGGTTGCTG 0: 1
1: 0
2: 5
3: 67
4: 540
Right 1043934239 8:86125146-86125168 GGTTGAGGATGTTAAGGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043934239 Original CRISPR GGTTGAGGATGTTAAGGTAA TGG Intronic
No off target data available for this crispr