ID: 1043942863

View in Genome Browser
Species Human (GRCh38)
Location 8:86215442-86215464
Sequence CTTTGTGAGGTCAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043942857_1043942863 -8 Left 1043942857 8:86215427-86215449 CCTATAATCCCAACACTTTGTGA 0: 31
1: 2912
2: 57304
3: 354561
4: 238949
Right 1043942863 8:86215442-86215464 CTTTGTGAGGTCAAGGTGGATGG No data
1043942856_1043942863 11 Left 1043942856 8:86215408-86215430 CCGGGCACAGTTGCTTACGCCTA 0: 1
1: 37
2: 1386
3: 14944
4: 58079
Right 1043942863 8:86215442-86215464 CTTTGTGAGGTCAAGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043942863 Original CRISPR CTTTGTGAGGTCAAGGTGGA TGG Intronic
No off target data available for this crispr