ID: 1043943596

View in Genome Browser
Species Human (GRCh38)
Location 8:86225015-86225037
Sequence ATAGGGAAGCAGACTGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 257}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043943596 Original CRISPR ATAGGGAAGCAGACTGGACA TGG (reversed) Intronic
901844342 1:11972540-11972562 AAAGGGAAGGAGGCCGGACATGG - Intronic
902365986 1:15974869-15974891 ATAAAGAAGCAGACTGGGCCGGG - Intronic
903659410 1:24967546-24967568 CAAGGGAAGCAGAAAGGACAAGG + Intergenic
904895298 1:33812822-33812844 ATAGAGAAACAGAATAGACATGG - Intronic
905245411 1:36609902-36609924 AGAGGGAAGGAGACAGGGCAAGG + Intergenic
908695285 1:66832999-66833021 ATAGAGCAGCAGAGTGGCCAAGG + Intronic
908788568 1:67758514-67758536 ATTGGGGAGCATGCTGGACAGGG + Intronic
908909016 1:69050923-69050945 AAAGGGAAACAGACTGGGCCAGG - Intergenic
909494113 1:76259024-76259046 ATAGGGAAACAGAATTGAGAAGG - Intronic
909583826 1:77266890-77266912 ACAGGGAAGCAGAATGAAGAAGG + Intergenic
910786664 1:91006428-91006450 CCAGGGAAGCAGTCTGGTCATGG - Intronic
910888783 1:91995224-91995246 AGAGGGAAGAAGAATAGACAAGG - Intronic
911284593 1:95974664-95974686 CTAGAGAAGCAGTCTGGCCATGG + Intergenic
915507759 1:156368278-156368300 ACAGGGAAGCAGGCTGGGCAGGG - Intergenic
916007752 1:160677618-160677640 ATAGGGATGCAGGCTGCTCAGGG + Intergenic
917083067 1:171276360-171276382 ATTGGGAAGAAGACTGAACTTGG - Intronic
917118625 1:171626370-171626392 AAAAGGAAACAGACTGGGCATGG - Intergenic
917787760 1:178477171-178477193 AAAGGGAAGGAGAATGGAGAAGG - Intronic
917897690 1:179507870-179507892 ATCAGGAAGAAGAGTGGACAAGG - Intronic
918832934 1:189422076-189422098 ATAGGCAAGCAGAATGAAGAAGG - Intergenic
921601020 1:217106625-217106647 ATAGGGAAGAAGACTGCTAAGGG - Intronic
921722568 1:218489583-218489605 ATAGTGAAGCACACTGAGCAGGG + Intergenic
923946054 1:238888779-238888801 ATAGAGAAGCAAACTCCACAGGG + Intergenic
1067832537 10:49618535-49618557 AGAAAGAAGCAGAGTGGACATGG + Intronic
1069219411 10:65864805-65864827 ATAGGGAATCAGAATGAAGAAGG + Intergenic
1073469764 10:103715276-103715298 ATGGGGAAACAGACTGGAAGAGG + Intronic
1076173389 10:128342168-128342190 ATAGGGAATAAGAATGGACTTGG + Intergenic
1077702126 11:4452478-4452500 ATAGGGAAGGAGCCTGGAAATGG + Intergenic
1078463308 11:11531578-11531600 ACAGGGTAGCAGAGTGGTCAGGG + Intronic
1080560452 11:33457972-33457994 CCATGGAAGCAGACGGGACATGG - Intergenic
1083366296 11:62143477-62143499 ATAGGGAAGAAGACCAGACTTGG - Intronic
1085187857 11:74591482-74591504 ATAGGGTAGCAGACCGGGCGCGG - Intronic
1086191070 11:84079829-84079851 ATAGGGAAGGTGACTGGAGGTGG - Intronic
1087929587 11:103961476-103961498 ATAGGGAAGCAGGCAGGTGAAGG + Intronic
1088177504 11:107070537-107070559 AAGGGGAAGCCAACTGGACAAGG + Intergenic
1088814921 11:113414309-113414331 CTAGGGAAGCCCACTGGCCATGG - Intronic
1089401475 11:118166841-118166863 AGAGGGGAGGAGACGGGACACGG + Exonic
1089410516 11:118237844-118237866 AAAGGGAAACAGGCTGGTCATGG + Intronic
1090480225 11:127061407-127061429 ATAGGGAAGTGCACTGGGCAAGG - Intergenic
1091746863 12:2998426-2998448 TCAGGGAAGCAGACTGAAAATGG + Intronic
1092460464 12:8681607-8681629 TTCGGGAAGCAGGCTGGAGAGGG + Intronic
1093974357 12:25404831-25404853 AGAGGAAAGCAGACTGGCCAGGG + Intergenic
1095324318 12:40869558-40869580 AAAGGAATGAAGACTGGACACGG - Intronic
1095607177 12:44083090-44083112 ATTGGGAAGAAAACTGGAAATGG - Intronic
1095785507 12:46104971-46104993 ATAGGGAAGGAGAGTAGAAAGGG - Intergenic
1097787522 12:63778234-63778256 ATAGGGAACCAGACCTGAGAAGG - Intergenic
1097964072 12:65560425-65560447 ATAGGGAAGGAGTCTGGAATAGG + Intergenic
1098729336 12:74012956-74012978 ATGGGGAAGGATACTGGTCAAGG - Intergenic
1100396646 12:94191491-94191513 ATAGGCATCCAGACTGGGCATGG + Intronic
1101386620 12:104263983-104264005 CTAGGGAAGCAGACAGGCCTGGG - Intronic
1101866063 12:108520467-108520489 AAAGGGATGCAGCCTGGCCATGG - Exonic
1102633063 12:114299120-114299142 TTAGGGAGTCAGACTGGTCATGG - Intergenic
1102937073 12:116906558-116906580 AGAGGGAGGCAGGCTGGGCATGG + Intergenic
1103025317 12:117569195-117569217 ATAGGAGAGCAGAATGCACAGGG + Intronic
1103529508 12:121591005-121591027 AGAGGGAACCAGAATAGACAGGG + Intergenic
1103973966 12:124689917-124689939 AGAAGGAAACAGTCTGGACAGGG + Intergenic
1105491798 13:20895301-20895323 ATAGGGAATGAGATTGCACATGG - Intronic
1106560948 13:30845756-30845778 AGAGGGAGGCAGGGTGGACAGGG + Intergenic
1107423279 13:40269427-40269449 CTGGGCAAACAGACTGGACAAGG + Intergenic
1107896345 13:44967577-44967599 ACAGGCAATCAGACTGGAAAGGG + Intronic
1109740003 13:66541001-66541023 TTAGGAAAGCAGACTGGATTGGG + Intronic
1111048275 13:82846164-82846186 ATAAGGTATCAGACTGGACATGG + Intergenic
1112325216 13:98439273-98439295 GGAGGGAAGGAGACTGGATAGGG + Intronic
1112346336 13:98593144-98593166 ATAGGGCAGCAGAATGGATGAGG + Intergenic
1113177538 13:107582246-107582268 ATAGGGCAGAAGCCTGGATAAGG + Intronic
1116737260 14:48707809-48707831 ATAGGGACGCAGACTTGGAAAGG - Intergenic
1117457645 14:55913863-55913885 CTAGGAATGCAGACAGGACACGG - Intergenic
1117558446 14:56910327-56910349 AGAGTGAGGGAGACTGGACATGG - Intergenic
1119884554 14:78129545-78129567 ATAGGACAGCAGAGTGGCCAGGG + Intergenic
1121514666 14:94541739-94541761 ATACAGAAGCTGACTGCACAGGG + Intergenic
1123061720 14:105597580-105597602 AAAGGGAAGCAGACAAGAAAAGG - Intergenic
1123086458 14:105719311-105719333 AAAGGGAAGCAGACAAGAAAAGG - Intergenic
1123430010 15:20206686-20206708 AAAAGGAAGCAGGCTGAACATGG + Intergenic
1124513603 15:30348067-30348089 AGAGGGGAGCAGAGGGGACAGGG - Intergenic
1124608182 15:31187283-31187305 AGAGGGAAGGAGACGGGAAAGGG - Intergenic
1124729318 15:32182698-32182720 AGAGGGGAGCAGAGGGGACAGGG + Intergenic
1125377089 15:39041613-39041635 AGAGGCAAGCATACTGGGCAGGG - Intergenic
1126477160 15:49077592-49077614 AGAAGTAAGCACACTGGACATGG - Intergenic
1128723775 15:69972805-69972827 GTAGGGCAACAGACTGGCCAAGG - Intergenic
1130056154 15:80527851-80527873 CTAGGGAAGATGGCTGGACAGGG + Intronic
1130336870 15:82963935-82963957 GTAGGGAAGCAGCCAGGGCATGG - Intronic
1130982885 15:88824946-88824968 ATAGGGGAGCAGGGTGGTCAAGG + Intronic
1131776144 15:95801018-95801040 AACTGGAAACAGACTGGACATGG - Intergenic
1132001979 15:98189842-98189864 ATAGGGAAACAGACTTAGCAAGG + Intergenic
1132292925 15:100715722-100715744 ATGGGGAAGAAGAGGGGACACGG - Intergenic
1132592127 16:730658-730680 ATGGGAGAGCAGACGGGACAGGG + Intronic
1134185979 16:12085317-12085339 AAAGGGAAGAAGAGTGGAGAAGG - Intronic
1136854624 16:33644533-33644555 AAAAGGAAGCAGGCTGAACACGG - Intergenic
1139324518 16:66141716-66141738 AGAGGGGAGCAGACTGTCCAAGG - Intergenic
1140405926 16:74711503-74711525 ACAGTGAAACAGACGGGACATGG - Intergenic
1140634790 16:76899173-76899195 ATAGGGTAGCAGAATAGAGAAGG + Intergenic
1203116201 16_KI270728v1_random:1493002-1493024 AAAAGGAAGCAGGCTGAACATGG - Intergenic
1144877713 17:18411089-18411111 GTGGGGAAGAAGACTGGAAAAGG - Intergenic
1145154516 17:20533314-20533336 GTGGGGAAGAAGACTGGAAAAGG + Intergenic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1150142526 17:62742308-62742330 ATAAGGAAGGAGGCTGGGCATGG - Intronic
1151168413 17:72224633-72224655 ATAAGGATGCCGACTGGGCATGG + Intergenic
1151199800 17:72459382-72459404 ATAGGGAAGCAGCATGTAGAGGG - Intergenic
1152000857 17:77644610-77644632 TGAGGGAGGCAGCCTGGACAAGG + Intergenic
1155311618 18:24529943-24529965 ATATGTAAGCAGGCTGGGCATGG + Intergenic
1156250489 18:35347528-35347550 AGAAGGAATCAAACTGGACATGG - Intergenic
1156250567 18:35348243-35348265 ACAGGGAAGCAGAATGGTCATGG - Intergenic
1156943526 18:42798621-42798643 ATAGGGAAGCAAACTTGTCAAGG + Intronic
1158186740 18:54780015-54780037 ATGGGGAAGCAGTCAGGAGAAGG - Intronic
1161914103 19:7216030-7216052 AGATGGAAGCAGGCTGGGCACGG + Intronic
1162028307 19:7906344-7906366 ATAGGGGGGCCCACTGGACAAGG + Intronic
1162119213 19:8451820-8451842 ATATTCAAGCAGACTGGCCATGG - Intronic
1162526906 19:11211516-11211538 ATAGGGGAGCAGACAGGTGAGGG - Intronic
1162879339 19:13646544-13646566 AAAGGGAAGAAGACAAGACACGG + Intergenic
1164444673 19:28307225-28307247 ATAGGGTAGCACAGTGGACGGGG + Intergenic
1166393986 19:42425387-42425409 ATAGGGAGGCAGCCTGGTCCAGG + Intronic
1166973951 19:46592470-46592492 GTAGGGAAGCCGACTGAGCATGG + Intronic
1167174853 19:47858777-47858799 AGAGGGATGGTGACTGGACAAGG + Intergenic
926300751 2:11600336-11600358 ATTGGGAAGCATTTTGGACAAGG - Intronic
926888668 2:17620346-17620368 TTCTGGAAGCAGTCTGGACAAGG + Intronic
927856081 2:26528774-26528796 ATGGGAAAGAAGACTGGGCAAGG + Intronic
928534347 2:32225711-32225733 ACAGACAGGCAGACTGGACATGG + Intronic
928613595 2:33015113-33015135 ACAGTGAAGCAAACTGGTCAAGG - Intronic
933993367 2:87649582-87649604 CTAGGGAATCAGGCTGGGCATGG + Intergenic
934520942 2:95019819-95019841 ACAGGGAGCCAGGCTGGACAGGG - Intergenic
935277055 2:101484168-101484190 AGGGGGAAGGAGAGTGGACAAGG - Intergenic
936300490 2:111301301-111301323 CTAGGGAATCAGGCTGGGCATGG - Intergenic
937715243 2:125024790-125024812 ACAGGCAAGAAGACTGGACCTGG + Intergenic
938183482 2:129206596-129206618 AGATGCAAGCAGACTGGACACGG - Intergenic
941744766 2:169074984-169075006 AGGGGGAAGCAGAATGGACAAGG + Intronic
941969782 2:171337155-171337177 AAGAGGAAGCAGACTGGGCATGG - Intronic
942086776 2:172451180-172451202 ATAGGGAAGGAGGCCGGGCACGG + Intronic
942494879 2:176529441-176529463 ATAGGGAAGGAGAGAGGAAAAGG - Intergenic
1170524839 20:17227168-17227190 ATAGAGAAAGAGACTGAACAGGG - Exonic
1173537689 20:43828563-43828585 AAAGGGAAGGAGGCTGGAGAAGG + Intergenic
1174688426 20:52478515-52478537 ATATGGAAGGGGACTGGAGAGGG - Intergenic
1175262381 20:57682687-57682709 ATGGGGACACAGACTTGACAGGG - Intronic
1175614997 20:60390466-60390488 AAAGGGAAGCAGAAGGGAAACGG - Intergenic
1176041847 20:63069870-63069892 ACAGGGAGGCAGGCTGGACCCGG + Intergenic
1177755172 21:25337800-25337822 ATAGATAAGAAGACTGGAGAAGG + Intergenic
1178861437 21:36292902-36292924 AAAGAAAAGCAGGCTGGACACGG - Intronic
1179022797 21:37655559-37655581 ATAGGAAGGTAGAATGGACAAGG + Intronic
1179287405 21:39989713-39989735 ATAGAGAAGCCGCATGGACAGGG - Intergenic
1179473845 21:41631025-41631047 AGAGGGAAGCACAGGGGACAGGG - Intergenic
1179625939 21:42649837-42649859 ACAGGGAAGGAGGCTGGAGATGG - Intergenic
1180045602 21:45303754-45303776 CTTGGGAGTCAGACTGGACAGGG - Intergenic
1181826535 22:25520771-25520793 ATAGAAAGGCAGACTGGAGAAGG + Intergenic
1181992753 22:26849961-26849983 ATTGGGAAGAAGAATAGACATGG - Intergenic
1182232868 22:28852028-28852050 TTTGGGAAGTAGAGTGGACAGGG + Intergenic
1183492551 22:38124358-38124380 ATATGGATGCGGACTGGACCTGG + Intronic
1183615170 22:38939831-38939853 CTAGGGAAGCTGACTTGGCATGG - Intergenic
1183618013 22:38956728-38956750 ACAGGGGAGCAGGCAGGACAGGG + Intronic
1183748237 22:39704520-39704542 ATGGGGAACCTGACTGGACCAGG + Intergenic
1184280227 22:43433255-43433277 ACAGGGCAGCAGAGGGGACAGGG - Intronic
1185361150 22:50407772-50407794 ACAGGAAAGAAGACTGGCCAAGG - Intronic
950037077 3:9893966-9893988 ATAGAGAAGTAGACTGGGTATGG + Exonic
950364910 3:12476058-12476080 AAAGGGAGGGAGATTGGACAAGG + Intergenic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
952887218 3:38019125-38019147 ATGGGGAGTGAGACTGGACATGG - Intronic
954046366 3:47934589-47934611 ATAAGAAAGCAGACTGGGCCAGG - Intronic
956056396 3:65303166-65303188 CTGGTGAAGCAGAATGGACAGGG + Intergenic
957685356 3:83498551-83498573 AAAGGGAAGCAGCATGGATATGG + Intergenic
959105304 3:102058637-102058659 ACAGGGAGTCAGACTGCACAGGG + Intergenic
959456799 3:106572756-106572778 ATAGTTAACCACACTGGACAGGG + Intergenic
960131108 3:114056972-114056994 AAAGGGAAGCAGAGGAGACATGG - Intronic
960274938 3:115718058-115718080 AAAGGGAAGTAGACTGGGAAAGG - Intronic
960419687 3:117428427-117428449 ATGGGGAAGTAGGCTGGGCATGG - Intergenic
960955167 3:123026632-123026654 AGAGGGATGCAGACGGGAGAGGG - Intronic
961999101 3:131276318-131276340 GGAAGGAAGCAGACTGGTCAGGG + Intronic
963781648 3:149492527-149492549 AAAGGAAAGCAGCCTGCACAGGG + Intronic
964718355 3:159746689-159746711 ATAGGGAAAGAGGCTGGAAATGG - Intronic
966428065 3:179802242-179802264 AAAGAAAAGCAGGCTGGACATGG + Intronic
967669899 3:192220309-192220331 ATAGGGAAGTAGAATGGTGAAGG - Intronic
968348632 3:198033191-198033213 GTTGGGAAGCAGAATGCACATGG - Intronic
968760967 4:2442667-2442689 TTCGGGAAGTTGACTGGACAAGG + Intronic
969693164 4:8718402-8718424 AGAGGGAAGCTGAATGGACTTGG + Intergenic
970207292 4:13667716-13667738 ATATGGAAGCAGATTTGAAATGG - Intergenic
972734719 4:41829502-41829524 TAAGGGAAGCAAACTGGACAGGG - Intergenic
974387654 4:61223730-61223752 ATAGGGAAGCAGACAGAAACTGG - Intronic
975675264 4:76821487-76821509 AGAGGGGAACAGACTGGAAAGGG + Intergenic
976084745 4:81395849-81395871 ATGGGGTAGCAGAGTGGCCAAGG - Intergenic
979440921 4:120748929-120748951 ATGGGGGAGCTAACTGGACATGG + Intronic
982163908 4:152597388-152597410 ACAGGGTAGCTGAATGGACAGGG - Intergenic
982409827 4:155062201-155062223 AAAAGGTAGGAGACTGGACAAGG + Intergenic
982816854 4:159896752-159896774 ATAGGGAAACAGATGGGAAATGG + Intergenic
984099918 4:175472769-175472791 AGAGGGAAGCAGCCCTGACAAGG - Intergenic
984366350 4:178804328-178804350 ATAGGGAGTCAGGCTGGAAAGGG + Intergenic
986007264 5:3678261-3678283 AGAGGGGAGGAGACTGGACGTGG + Intergenic
986147725 5:5094932-5094954 ATAGTAAAGTAGGCTGGACATGG + Intergenic
986605376 5:9517800-9517822 ACAGGAAAGCAGACTGGAGAGGG - Intronic
986625614 5:9721058-9721080 ATAGGTAAGCAGGTTGCACATGG - Intergenic
987783668 5:22470706-22470728 ATAGAAAAGAAGACTGGGCAAGG - Intronic
988702735 5:33691575-33691597 CTAGGGAAGCAGGCGAGACATGG + Intronic
989372679 5:40725664-40725686 AGAGGGAAGGAGACTGGGAAAGG - Intronic
989506227 5:42230081-42230103 ATTGGGAAGCAACCTGGAAATGG - Intergenic
989800719 5:45535305-45535327 ATAGAGAAGCAGGCTGGGCATGG + Intronic
989982903 5:50665394-50665416 ATAGTGAATATGACTGGACAAGG + Intergenic
990219156 5:53567696-53567718 AAAGGGAAGCAGACCAGTCAAGG - Intronic
990806439 5:59667959-59667981 AGAGGAAAGAATACTGGACAAGG - Intronic
991047242 5:62235643-62235665 AAAAGGAAGCAGGCTGAACACGG + Intergenic
991090435 5:62689230-62689252 AAAGGGAAACAGGCTGGGCATGG + Intergenic
991572994 5:68075095-68075117 ATAGGAAACCAGATTGGGCAGGG - Intergenic
991901550 5:71465551-71465573 AAAGAGAAACAGACAGGACATGG - Intronic
991914649 5:71593888-71593910 ATAGTGAAGAAGACTGGATTTGG + Intronic
992736058 5:79722983-79723005 TTAGTGAAGCAGTCTGGACCTGG - Intronic
993564663 5:89458310-89458332 ATATAAAAGCAGACTGGGCAAGG - Intergenic
994083926 5:95738234-95738256 ATAGGGAAGTAGAGGGGATATGG - Intronic
994558723 5:101339053-101339075 AAAGTGAAGCAGGCTGGACCAGG + Intergenic
995323425 5:110862924-110862946 ATAGTGAATGAGACTGCACAGGG - Intergenic
995554038 5:113309366-113309388 AGAGGCATGCAGAGTGGACATGG - Intronic
996282072 5:121742097-121742119 ATATGGAAGTATACTGCACAAGG + Intergenic
997273931 5:132566561-132566583 ATAGGAAGGCAGCCTGGACAAGG - Intronic
1001072282 5:168597318-168597340 AAAGGGAAGGAGACAGTACAAGG - Intergenic
1002113227 5:176935647-176935669 ATAAGTGAGAAGACTGGACAGGG + Intronic
1002475040 5:179460124-179460146 ATGGGGAAGGAGCCTGGACCAGG + Intergenic
1004764486 6:18710191-18710213 ATAAGAAAGAAGACTGGAGAAGG - Intergenic
1004796727 6:19094778-19094800 ATAGGTAAGAAGTCTGGACGTGG + Intergenic
1005287971 6:24349391-24349413 ACATGGAAGCAGAGAGGACAAGG + Intronic
1005621310 6:27623052-27623074 ATAAAGAAGCAGACAGTACAAGG + Intergenic
1006113104 6:31760663-31760685 ATAGGGAAGGAGACAGGGCCTGG - Intronic
1007125263 6:39420965-39420987 CTAGAGAAGCAGACAGGACATGG + Intronic
1007166019 6:39829725-39829747 CTAGGGATGCAGACTGAACCTGG + Intronic
1007182365 6:39938823-39938845 AGAGGGAAGCAGGCATGACATGG + Intergenic
1007409580 6:41654051-41654073 CTAGGAAAGGAGACTGGAGAGGG - Exonic
1009768920 6:68120134-68120156 AAAGACAATCAGACTGGACATGG + Intergenic
1013355407 6:109341926-109341948 TCATGGAAGCAGGCTGGACATGG + Intergenic
1013752222 6:113420566-113420588 ATAGGAAGGCAGACACGACATGG + Intergenic
1016920740 6:149290504-149290526 ATAGGAAAGCAGAAGGGACAAGG - Intronic
1017098548 6:150826927-150826949 AGAGAGAATCAGGCTGGACACGG - Intronic
1017419448 6:154258607-154258629 ATTAGGAAGCAACCTGGACATGG - Intronic
1020578389 7:9963482-9963504 ATCAGGAAGCAGGCTGGGCATGG + Intergenic
1021918844 7:25463261-25463283 ATAGCAAAGAAGACTGGAGATGG + Intergenic
1022015157 7:26343297-26343319 CTAGGGAAGCAGACTGGCTTTGG + Intronic
1022518835 7:30992796-30992818 ACAGGGATGAAGACTGGGCAGGG + Intronic
1023377384 7:39571115-39571137 ATAGAGCATCAAACTGGACAAGG - Intronic
1023505031 7:40890422-40890444 ACAGGGAAGCGGCCTGGACATGG - Intergenic
1023633455 7:42185336-42185358 ATAAGAAAGCAGCCTGGAGAAGG - Intronic
1023909958 7:44546832-44546854 ATAGAAAAGCAGGCTGGGCATGG + Intergenic
1025139251 7:56448847-56448869 AAAAGGAAACAGGCTGGACATGG + Intergenic
1025624261 7:63205443-63205465 AAAGGGCAGCTGACTGAACATGG + Intergenic
1027399005 7:77788270-77788292 AAAGGGAATAAGACTGGGCATGG + Intergenic
1029731435 7:102440840-102440862 ATAAGGAAACAGGCTGGACAAGG - Intronic
1030093729 7:105879017-105879039 ATAGGGAAGCAGAAGGGAAAGGG - Intronic
1032628174 7:133616046-133616068 ATAGGTAAACAGACTGGCAATGG - Intronic
1032753930 7:134870200-134870222 ATCAGGAAGCAGACAGGCCAGGG + Intronic
1033943670 7:146686870-146686892 ATAGGGATGCATGCTGGAAATGG + Intronic
1034410614 7:150939685-150939707 TTAGGGAAACAGTCTGGAGAGGG - Intergenic
1036956636 8:13194715-13194737 ATAAGAAAGCAGGCTGGGCATGG + Intronic
1038680921 8:29666093-29666115 TTAGGGAAGAAGAATGGAAAGGG - Intergenic
1040816674 8:51515191-51515213 ATATGGAAGCACCCTGGTCATGG + Intronic
1041157179 8:55000140-55000162 ATAAGGGAACAGACTGGAAAAGG - Intergenic
1043943596 8:86225015-86225037 ATAGGGAAGCAGACTGGACATGG - Intronic
1044712141 8:95068195-95068217 GTAAGAAAGCAGACTGGCCAGGG - Intronic
1045325701 8:101116270-101116292 ATAGGAAAGCAGAGTAGGCAGGG + Intergenic
1046441285 8:114258214-114258236 ATGGGGAAGCAAACCGGGCAAGG + Intergenic
1047520450 8:125591796-125591818 ATAGGAAGGCAAACAGGACATGG - Intergenic
1049251207 8:141590068-141590090 ACTGGGAGTCAGACTGGACAGGG + Intergenic
1050453032 9:5804152-5804174 ATAGGGAACCAAACAGGAAAAGG - Intronic
1051630470 9:19135975-19135997 CTAGGAAGGCAGACTGGAAAGGG - Intronic
1052326005 9:27217317-27217339 AAAGGGAAGCAGGGTGGAAAAGG - Intronic
1052801265 9:32970362-32970384 ATAGTCACACAGACTGGACATGG - Intergenic
1057055813 9:91959858-91959880 AGAGAGAAGCAGGCTGGGCACGG - Intergenic
1057456029 9:95211747-95211769 TTAAGGAAGCAGGCTGGAAATGG + Intronic
1058840008 9:108897071-108897093 AAAGGTAAGTAGGCTGGACAAGG + Intronic
1058960363 9:109987417-109987439 AAAGGAAAGCAGGCTGGTCATGG - Intronic
1059067692 9:111102759-111102781 ACAGGGGAGCAGACTGGGGAGGG + Intergenic
1059502508 9:114767006-114767028 ATAAGGAAACAGGCTGGGCATGG - Intergenic
1060234604 9:121853525-121853547 GTGGGGATGCAGAGTGGACAGGG + Intronic
1060485174 9:124042017-124042039 TGAGGGAAGCAGACAGGACAGGG - Intergenic
1061570933 9:131477047-131477069 AGAGGGGAGCAGGCTGCACATGG + Intronic
1185651190 X:1649194-1649216 ACAGCAAAGCAGACTGGGCACGG - Intergenic
1186265689 X:7831038-7831060 AGAGGGAAGAAGGCTGGGCATGG + Intergenic
1186421248 X:9428402-9428424 ATAGGAAAGTAGACTGGGCGCGG + Intergenic
1187520678 X:20011264-20011286 ACAGGGAAGCAGATTGAGCAGGG + Intronic
1189750328 X:44213958-44213980 ATGGGGTAGTAAACTGGACATGG + Intronic
1190049768 X:47141034-47141056 AGAGAGAAGCAGAGAGGACAGGG + Intergenic
1190887257 X:54540945-54540967 ATAAGGAAGAAGGCTGGGCAGGG - Intronic
1190888439 X:54549182-54549204 ACATGGAAGCAGACTGGACAAGG + Intronic
1192916412 X:75656016-75656038 ATGGGGTTGCAGACTGGATAGGG + Intergenic
1192925132 X:75748018-75748040 AAAGGGAAGAAAACTGGCCAGGG - Intergenic
1200149987 X:153946661-153946683 GGGGGGAAGCAGACTGGCCAGGG - Intergenic
1200504399 Y:3994902-3994924 AAAGGGAAGCAGGCTGGGCGTGG + Intergenic