ID: 1043944024

View in Genome Browser
Species Human (GRCh38)
Location 8:86229804-86229826
Sequence GTGGTGTGAAAGAAGTGACT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043944024_1043944026 10 Left 1043944024 8:86229804-86229826 CCAAGTCACTTCTTTCACACCAC 0: 1
1: 0
2: 1
3: 5
4: 166
Right 1043944026 8:86229837-86229859 AATTCCTACAATCCACAACATGG 0: 1
1: 0
2: 0
3: 6
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043944024 Original CRISPR GTGGTGTGAAAGAAGTGACT TGG (reversed) Exonic
901150049 1:7095325-7095347 GTGTTGTGAAGGAAGGGACCTGG + Intronic
903028529 1:20446371-20446393 CTGGGGTGATGGAAGTGACTGGG + Intergenic
904424133 1:30412810-30412832 GAGGTCTGAGTGAAGTGACTAGG - Intergenic
905717353 1:40163154-40163176 GTGCTTAGAAAGAAGTAACTGGG + Intronic
906658672 1:47567101-47567123 TTGGTGTCAATGAAGAGACTAGG - Intergenic
909523264 1:76593764-76593786 GTGCTTTGAAAGCAGAGACTGGG - Intronic
909777893 1:79506692-79506714 CTGGTTGAAAAGAAGTGACTGGG + Intergenic
911680057 1:100704915-100704937 CTGGTGTGAAAGACTTAACTGGG + Intergenic
913239183 1:116813996-116814018 GTGGGGTGAAGGAAGGGACCTGG + Intergenic
916671048 1:167020510-167020532 GTGGTGAGAAATAACTGTCTAGG - Intronic
917145439 1:171885632-171885654 GGGGTGTCAAAGATGTGACAGGG + Intronic
919426138 1:197433477-197433499 GTGGTTTTAGTGAAGTGACTGGG + Intronic
921922718 1:220686907-220686929 GTGGTGAGAGAGTAGGGACTGGG - Intergenic
923097439 1:230786866-230786888 GTGGTGTGGAAGGGGTGACATGG + Intronic
923346043 1:233053432-233053454 GTGCTATGAAAGAAGTAAATAGG - Intronic
924579791 1:245313897-245313919 GTGCCATGAAAGAAGAGACTGGG - Intronic
1062945230 10:1456334-1456356 GTGTTGAGAAGGAAGTGACTTGG - Intronic
1064261643 10:13790962-13790984 GTGAGGTGACAGAAGGGACTGGG + Intronic
1065071592 10:22030567-22030589 GTGGTTTGGAAGCTGTGACTTGG + Intergenic
1066232173 10:33446831-33446853 GTGGTGTGCAAGAGGTGTTTGGG + Intergenic
1067350601 10:45472257-45472279 GTGCAGTGAAAGAAATGAATAGG - Intronic
1067568428 10:47354331-47354353 GTTGTCTGAAAGAAGTGGCAGGG + Intronic
1072164315 10:92798087-92798109 TTGGTGTGAACGCAGTGATTAGG + Intergenic
1074926706 10:118080533-118080555 GGGGTGAGAATGGAGTGACTTGG + Intergenic
1075919277 10:126197135-126197157 GTGGTGTGGAAGACATGGCTAGG + Intronic
1076505278 10:130968651-130968673 CTGGTGTGAAGGACATGACTGGG - Intergenic
1076836622 10:133024188-133024210 AAAGTGTGAAAGACGTGACTGGG + Intergenic
1077030915 11:466790-466812 GTGGAGGGAGGGAAGTGACTGGG - Intronic
1079350281 11:19686204-19686226 GTGGTATGAAGCAAGTGACATGG - Intronic
1080114620 11:28607721-28607743 GTGCTGAGAAACAACTGACTGGG - Intergenic
1080956073 11:37097469-37097491 GTGGTGTGCTAGAACTGGCTGGG + Intergenic
1081865419 11:46357162-46357184 CGGATGTGAAAGAAGAGACTGGG + Intronic
1081952932 11:47061186-47061208 TTGGTGATAAAGCAGTGACTGGG + Intronic
1084765979 11:71308772-71308794 GTGGTCTTAAAGAAGACACTCGG + Intergenic
1085903758 11:80734588-80734610 GTTCAGAGAAAGAAGTGACTTGG - Intergenic
1088801425 11:113310786-113310808 GTGGTGTTTAAGAAGAGACTTGG - Intergenic
1089842723 11:121432337-121432359 GTGGTTAGGAAGAAGTGTCTAGG - Intergenic
1092660352 12:10732079-10732101 GTGGAGTGAGACAAGTGACAAGG + Intergenic
1094702742 12:32885961-32885983 GTGGTTTAAAAAAAGTGATTTGG + Intronic
1097415135 12:59305803-59305825 AATGTGTCAAAGAAGTGACTAGG + Intergenic
1097970073 12:65624040-65624062 GTGATGTGATAGAGATGACTGGG - Intergenic
1101000501 12:100352971-100352993 GGGGTGTGAAACAAGAGCCTGGG - Intergenic
1103434569 12:120914965-120914987 GTGGTGTGTAAGAAGTACCGGGG + Intergenic
1104157520 12:126148207-126148229 GTGATGTTAAGCAAGTGACTTGG - Intergenic
1104271102 12:127282892-127282914 GTGGTGGATAAGAAGTGACTAGG + Intergenic
1106814715 13:33394756-33394778 GAGGTGTGAAAGATGTGAAAAGG + Intergenic
1107308188 13:39045987-39046009 GAGGTATGAAAGAATGGACTGGG - Intronic
1107991842 13:45825654-45825676 TTGGTGAGCAAGAAGTTACTTGG + Intronic
1112459489 13:99590627-99590649 GTGGTGGGAAAGCAGAGACCAGG - Intergenic
1116053384 14:39832835-39832857 GTTTTGTGGAAGAATTGACTAGG - Intergenic
1117546270 14:56797052-56797074 TTGGTGTGACAGAAAAGACTGGG - Intergenic
1120484610 14:85096781-85096803 GTGGGGAGAAAAAAGTGAATGGG - Intergenic
1120605314 14:86569285-86569307 GTGCTCTGAAAGGAGTAACTAGG - Intergenic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1124692981 15:31841135-31841157 GTGGTGTGGCAGAATTGCCTGGG + Intronic
1125187654 15:36950171-36950193 GAGGTGTGAAAGGGGTGATTAGG - Intronic
1125461037 15:39907030-39907052 GTGATGTGATAGAAGTGATTGGG + Intronic
1125477191 15:40055257-40055279 GTGGAGGGTAAGAGGTGACTGGG + Intergenic
1129622765 15:77164383-77164405 CTGGTGTGAATGAAGTAGCTAGG + Intronic
1131217651 15:90552566-90552588 GTGGTGTGATAAAGATGACTCGG + Intronic
1134889513 16:17827009-17827031 CTGGCTTGAAAGAAGTAACTAGG - Intergenic
1135413753 16:22253635-22253657 ATGATGTGACAGAGGTGACTGGG - Intronic
1138202955 16:55103756-55103778 GTGGAGTGAGAGAAGTGGGTTGG - Intergenic
1140243325 16:73225146-73225168 GTGATGTGAAAGACAAGACTTGG - Intergenic
1140948678 16:79795376-79795398 GTGGTGTGAAAGAAAATACAAGG - Intergenic
1141048136 16:80735751-80735773 GTGGTCTGAAAGCAGTGCCATGG - Intronic
1145914949 17:28567437-28567459 ATGGTGTGAAAGAAATGTATGGG + Intronic
1146100143 17:29972999-29973021 GTGGTTTGAAAGCAGTGAGCTGG + Intronic
1147390065 17:40103623-40103645 GTGGTGTGAAGGCAGAGGCTGGG + Intergenic
1148169185 17:45505028-45505050 GTGCTGGGAAAGAGTTGACTAGG - Intergenic
1148279636 17:46337979-46338001 GTGCTGGGAAAGAGTTGACTAGG + Intronic
1148301853 17:46555835-46555857 GTGCTGGGAAAGAGTTGACTAGG + Exonic
1148366340 17:47058354-47058376 GTGCTGGGAAAGAGTTGACTAGG + Intergenic
1148937053 17:51171771-51171793 CTGAGCTGAAAGAAGTGACTTGG + Intergenic
1150125182 17:62630553-62630575 GTTGAGTGAAAGAGGTGCCTGGG + Intronic
1150400381 17:64851496-64851518 GTGCTGGGAAAGAGTTGACTAGG - Intergenic
1150500233 17:65643602-65643624 GTGGTGTGTAAGAAGTACCAGGG - Intronic
1150913850 17:69416018-69416040 TTGTTCTGAAACAAGTGACTTGG - Intronic
1152007733 17:77693113-77693135 GTGGTGTGAAGAAAGTCATTTGG + Intergenic
1156133043 18:34001915-34001937 GTGCTGTGAAAGCATGGACTAGG + Intronic
1159393219 18:67822362-67822384 GTGGTGGGAAAGATATGGCTAGG + Intergenic
1160512552 18:79460785-79460807 GAGGTGTGAGAGTAGTGACGGGG - Intronic
1165252904 19:34555002-34555024 CTGCTGTGAAAGAAGTGAGGAGG + Intergenic
1167045647 19:47047339-47047361 GTTCTGAGAAAGAAGTGAGTGGG - Intronic
1167518380 19:49937222-49937244 TTGGAGTGATAGAAGTGATTAGG - Intronic
928267307 2:29822573-29822595 GTGGTGTGTAAAAATTGACCTGG + Intronic
930735261 2:54772291-54772313 GTGGTGTGAGAGAAGTGCTATGG + Intronic
931338643 2:61376439-61376461 GTTGTGTGAAAACAGTGAATGGG - Intronic
936087914 2:109481872-109481894 GTGGTGATAAAACAGTGACTTGG - Intronic
937289495 2:120773663-120773685 GTGGGGTGAGGGAAGTGATTGGG + Intronic
939231602 2:139433044-139433066 GAGGATTGAAAGGAGTGACTCGG + Intergenic
939734000 2:145820777-145820799 GTGGAGTGAGAGAAGTGAGCAGG - Intergenic
941716383 2:168767906-168767928 GTGGTGTGACAAAAGAGACCTGG - Intronic
944992491 2:205253920-205253942 GTGGTTTGAAAGAAGAGGTTGGG + Intronic
945412443 2:209527495-209527517 GTGGTGAGAAAGAAGAGAGGCGG - Intronic
1169900448 20:10547332-10547354 GTTGTGGAAAACAAGTGACTGGG + Intronic
1170570282 20:17628684-17628706 GAGGTGGGAATGAACTGACTTGG - Intronic
1184132033 22:42522539-42522561 GCGATGTGAGTGAAGTGACTTGG - Intergenic
950952326 3:17013484-17013506 GTGGTGTAATAAGAGTGACTGGG + Intronic
951081598 3:18456329-18456351 ATGGAGAGAAAGAATTGACTTGG - Intergenic
952099144 3:29991471-29991493 GATGTGTGATGGAAGTGACTAGG + Intronic
953769032 3:45764794-45764816 GGGGTGTGAAGGAACTGTCTAGG + Intronic
954512641 3:51139985-51140007 CTTGTGTGAAACAATTGACTCGG - Intronic
954608154 3:51929561-51929583 GGGGTGAGCAGGAAGTGACTGGG + Intergenic
955112246 3:55960534-55960556 GTGCTGTGAAACAAGTGCATGGG - Intronic
956524430 3:70142038-70142060 TTGGTGTGAATGCAGTGAATAGG + Intergenic
963316648 3:143765982-143766004 CTGGTATGACATAAGTGACTGGG - Intronic
964940193 3:162150660-162150682 GTTGTGCGAGAGAAGTGACAGGG + Intergenic
965777462 3:172246843-172246865 GTGTTGTGAAAGAAGATGCTTGG - Intronic
966115891 3:176459875-176459897 GTTGTGTGGTAGCAGTGACTAGG - Intergenic
970317463 4:14843047-14843069 GTGGTCTTTAAGAAGTGATTAGG - Intergenic
972485514 4:39536488-39536510 GGGGTGAGAAAGAACAGACTGGG - Intergenic
976845470 4:89484050-89484072 TGGCTATGAAAGAAGTGACTAGG - Intergenic
977670318 4:99687351-99687373 GTGGAGTGAATGATGTGACCTGG + Intergenic
978806036 4:112801462-112801484 GTGGTGGGAGACAAGTGAATAGG + Intergenic
978833242 4:113115076-113115098 GTGGTGTCAAAGCAGTCATTAGG - Intronic
980794144 4:137659134-137659156 ATGGGGCTAAAGAAGTGACTTGG - Intergenic
981243662 4:142508668-142508690 GTGGTGTGATAGTTGTGATTAGG + Intronic
982405052 4:155010178-155010200 GTGGTGTGAAATATGGGAATGGG - Intergenic
985817430 5:2137161-2137183 GTGGGTGGACAGAAGTGACTAGG + Intergenic
991932102 5:71763541-71763563 GTGGTGGGAAAGACCTGACAGGG + Intergenic
994276849 5:97848976-97848998 AGAGTCTGAAAGAAGTGACTGGG + Intergenic
994825281 5:104705901-104705923 GTGGTGTGAAAGATGTCACTTGG - Intergenic
995037728 5:107553915-107553937 GATGTGTGGAAGAAGTTACTAGG - Intronic
995280130 5:110325314-110325336 CTGGTGTCAAAGCAGTTACTGGG - Intronic
997359382 5:133284917-133284939 GTGCTGTGAAAGGACTGGCTAGG + Intronic
1000611441 5:163379552-163379574 GTGGTGAGAAAGAACTGAAATGG + Intergenic
1001319571 5:170669092-170669114 ATGGTGTGAATAAAGGGACTGGG + Intronic
1001494383 5:172177716-172177738 CTGGTTTGAATGAGGTGACTAGG + Intronic
1002045556 5:176539864-176539886 ATGGTGTGAGAGGAGGGACTGGG - Intergenic
1002912504 6:1501139-1501161 GTGGAGTGAAAGAGGTGAGGGGG + Intergenic
1005858459 6:29882429-29882451 GAGATGTGATAGAAGTGATTTGG - Intergenic
1005866003 6:29937272-29937294 GAGATGTGATAGAAGTGATTTGG - Intergenic
1006108636 6:31730981-31731003 GTGGTGTGTAAGAAGTACCGGGG - Exonic
1007189634 6:40002681-40002703 GTGGCCTGAAAAATGTGACTTGG + Intergenic
1007642515 6:43353884-43353906 GTGGGAAGAAAGCAGTGACTGGG - Intronic
1008066260 6:47052006-47052028 ATGGTGTGAAACAAATGAGTAGG - Intergenic
1009895360 6:69742938-69742960 GTGGTGAGAAATAAGTCTCTAGG - Intronic
1012477792 6:99634222-99634244 GCGATGTGACAGAAGGGACTGGG + Intergenic
1013958765 6:115872358-115872380 GTGGTGTGAATCAAGTGGCCAGG - Intergenic
1022797220 7:33741755-33741777 GTGGTTAGAAAGCAGTGTCTGGG + Intergenic
1024507633 7:50175732-50175754 GAGGTGTGAAATGAGTGACCAGG - Intergenic
1029012382 7:97275383-97275405 ATGGAGTGAAAGAAGTTAATAGG - Intergenic
1029049742 7:97672612-97672634 GTGGGGTGGAAGAGGTGACAAGG - Intergenic
1035672940 8:1433979-1434001 TTGGAGAGAAAGAAGGGACTTGG + Intergenic
1037164640 8:15811689-15811711 GAGGGGTGAAGGAAGTGAATAGG + Intergenic
1037576172 8:20205454-20205476 GTGCTGTGAAAGATGATACTGGG + Intronic
1039752410 8:40490443-40490465 GAGATGAGAAAAAAGTGACTTGG - Intergenic
1039892193 8:41693277-41693299 GTGGTGTGCAAGGTGAGACTGGG + Intronic
1039940773 8:42088784-42088806 GTGATGAGCAAGAAATGACTGGG + Intergenic
1039953180 8:42187897-42187919 GTGCTGTGAAATAGGTGAGTAGG - Exonic
1041271581 8:56114011-56114033 CTGGAGTGAATGAAGAGACTAGG + Intergenic
1043944024 8:86229804-86229826 GTGGTGTGAAAGAAGTGACTTGG - Exonic
1045046082 8:98280102-98280124 GTGGAGCGAAAGCAGTGATTTGG + Intronic
1045799562 8:106086868-106086890 GTGGGGTGAGGGAAGTGTCTGGG + Intergenic
1048115498 8:131517286-131517308 GTGGTGCAACAGAAATGACTGGG - Intergenic
1048892138 8:138957551-138957573 GTGGTGGAAAAGAAGCCACTGGG + Intergenic
1050905905 9:11005224-11005246 GTGGCCTGTAAGAAGTGATTAGG - Intergenic
1055158464 9:73095003-73095025 GTGGCTTGTAAGAAGTCACTAGG - Intergenic
1055619246 9:78106786-78106808 GTGGTTTGAAAGTTGTGGCTGGG + Intergenic
1057051258 9:91925876-91925898 CTGGTGAGAAACAAGTCACTTGG + Intronic
1058666150 9:107317815-107317837 GGAGTCTGTAAGAAGTGACTTGG + Intronic
1059150707 9:111947373-111947395 GGGGTGTGAAAGAAGAAAGTGGG + Intergenic
1059567796 9:115400562-115400584 GTGGTCTTTAAGAAGTGATTAGG - Intronic
1059897756 9:118887103-118887125 CTGGAGTGACAGCAGTGACTGGG - Intergenic
1186455108 X:9704457-9704479 GTGGGGTGCAAGAAGTGTCACGG + Intronic
1186962517 X:14751872-14751894 GTACTGTGAAAAAAGTGACCTGG - Intergenic
1187998308 X:24953437-24953459 GTGGTTTGATAGAAGTGGATAGG + Intronic
1189855800 X:45223872-45223894 GTGGTGTCAGAGAGGTTACTGGG - Intergenic
1192749552 X:73975041-73975063 GTGGTATGAAAAATGTTACTGGG - Intergenic
1193222827 X:78946888-78946910 TTGGTTTGAAATAAGTGAGTTGG + Intronic
1197673178 X:129301331-129301353 TTTGTGTGAAAGAAGGGCCTAGG - Intergenic
1199597363 X:149516723-149516745 GAGGTGGGAGAGAAGTGACTTGG - Intronic