ID: 1043960862

View in Genome Browser
Species Human (GRCh38)
Location 8:86416970-86416992
Sequence AGTGAGTCCCCAGAATGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 173}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043960862_1043960870 19 Left 1043960862 8:86416970-86416992 CCACCACATTCTGGGGACTCACT 0: 1
1: 0
2: 1
3: 11
4: 173
Right 1043960870 8:86417012-86417034 CAAGCCTTGGACACATACCCTGG No data
1043960862_1043960871 20 Left 1043960862 8:86416970-86416992 CCACCACATTCTGGGGACTCACT 0: 1
1: 0
2: 1
3: 11
4: 173
Right 1043960871 8:86417013-86417035 AAGCCTTGGACACATACCCTGGG No data
1043960862_1043960865 -7 Left 1043960862 8:86416970-86416992 CCACCACATTCTGGGGACTCACT 0: 1
1: 0
2: 1
3: 11
4: 173
Right 1043960865 8:86416986-86417008 ACTCACTTTTGGTAGCTACCAGG No data
1043960862_1043960866 6 Left 1043960862 8:86416970-86416992 CCACCACATTCTGGGGACTCACT 0: 1
1: 0
2: 1
3: 11
4: 173
Right 1043960866 8:86416999-86417021 AGCTACCAGGTCCCAAGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043960862 Original CRISPR AGTGAGTCCCCAGAATGTGG TGG (reversed) Intronic
901845317 1:11978463-11978485 AGGGAGTCCAGAGATTGTGGAGG + Intergenic
902734836 1:18393416-18393438 AATCAGTCCCCAGAATGAGAAGG - Intergenic
903172947 1:21564841-21564863 AGCGAGTGCCCAGAAGGTGGTGG + Intronic
903950863 1:26995010-26995032 AATGAGGCCCCAGGATGGGGTGG + Intronic
910232701 1:85002981-85003003 TGTGAGTGCCCAAAATGTGAAGG + Intronic
911594279 1:99782800-99782822 GGAGAGTGCACAGAATGTGGTGG - Intergenic
913339857 1:117747672-117747694 TGTGAGTGCCCAAACTGTGGAGG - Intergenic
913538658 1:119798010-119798032 ATCCTGTCCCCAGAATGTGGTGG - Intronic
914982630 1:152428432-152428454 AATGAGTACCCAGACTGTGATGG - Intergenic
915478036 1:156165278-156165300 AGGGAATCCCCAGAATGATGAGG - Intronic
915598097 1:156906637-156906659 AGTGTGCCCCAGGAATGTGGGGG + Exonic
915994362 1:160548698-160548720 AGTGAGTCCCCACTATGTATAGG - Intronic
918489825 1:185069540-185069562 AGTGAGACCCTAGCATGTGCTGG - Intronic
919739769 1:200974528-200974550 AGTGAGTGCCCACCATGTGCTGG - Intronic
920511932 1:206557919-206557941 AATGGCTCTCCAGAATGTGGGGG + Intronic
922746047 1:228044663-228044685 ACTCAGTCCCCAGAATAAGGTGG + Intronic
1062957313 10:1548879-1548901 AGTGAGTGGCCAGAGTGTGAGGG + Intronic
1063981451 10:11455223-11455245 AGAGACTCCCCAGCATGTAGGGG - Intronic
1065277851 10:24104030-24104052 AATGAATCCCCACAATGTGTGGG - Intronic
1065641364 10:27785985-27786007 CCTGAGACCTCAGAATGTGGAGG + Intergenic
1066030603 10:31419540-31419562 AATGAGTGCCCACTATGTGGCGG - Intronic
1066309071 10:34177803-34177825 AGAGAGACACCAGAAAGTGGGGG + Intronic
1068257133 10:54526761-54526783 AGTGATTTCACAGAATGTGTGGG + Intronic
1071255458 10:83868153-83868175 AGTGATCCCCCAGAATGCTGAGG - Intergenic
1072118486 10:92385842-92385864 AGTCAGTCCTCAGGAGGTGGGGG + Intergenic
1076650848 10:131986235-131986257 AGGGAGTCCCCAGAGTTTTGGGG + Intergenic
1078930744 11:15910603-15910625 AGTGTGTCCACAGACTTTGGGGG - Intergenic
1079084343 11:17434263-17434285 AGTCAAGCCCCAGAATGTGAAGG - Intronic
1080248805 11:30209714-30209736 AGTGAGCCTCCAGGTTGTGGCGG + Intergenic
1082250733 11:49977283-49977305 AGTAAGGACGCAGAATGTGGTGG + Intergenic
1084420254 11:69057123-69057145 AGAAAGTCCCCAGAAGGCGGTGG - Intronic
1085250879 11:75143020-75143042 AGTGTGTGCACAGAATGTGGGGG + Intronic
1087281800 11:96219170-96219192 ATTGAGTGCCCAGTATGTGAAGG - Intronic
1088306888 11:108420467-108420489 AGTGACTGAGCAGAATGTGGTGG - Intronic
1088970816 11:114773288-114773310 TATGAGTGCCCAGAATGGGGTGG - Intergenic
1089527074 11:119104151-119104173 AGTGAGACACCAGAAGCTGGTGG + Intronic
1090582843 11:128178857-128178879 AGGGAGTCCACAGTAAGTGGGGG - Intergenic
1091262618 11:134246138-134246160 AGTGAGTGGCCAGAAGGAGGTGG - Exonic
1091556146 12:1574776-1574798 AGTAAGTCCCCAGAGTAAGGCGG - Intronic
1093423269 12:18999143-18999165 AGTGAGTCACCAAAATAAGGAGG - Intergenic
1094487115 12:30934021-30934043 TGGGAGTCCCCAGAACCTGGAGG + Intronic
1094625347 12:32118414-32118436 AGTCAGGCCCCAGAATCTGTGGG + Intronic
1096111674 12:49032484-49032506 TGTGAGTCCCCAGAGAGTGAGGG + Exonic
1096771108 12:53936626-53936648 AGGGAGCCCCAAGAATGGGGTGG + Intergenic
1100550769 12:95644481-95644503 AGTGAGACTCCAGAAGGAGGAGG - Intergenic
1101079877 12:101171764-101171786 AGTGGGTGGCCAAAATGTGGTGG + Intronic
1101840565 12:108324818-108324840 ACTGAGCACCCACAATGTGGTGG + Intronic
1102242013 12:111330298-111330320 GGTGAGTCCCCAGAGCCTGGGGG - Intronic
1102734014 12:115141289-115141311 AGGGAGCGCCCAGAATTTGGGGG - Intergenic
1102994866 12:117341336-117341358 ACTGAGGCCCCAGAACTTGGTGG + Intronic
1104228906 12:126864725-126864747 AGTGATTCCACAGAGTGTGAAGG + Intergenic
1104517965 12:129445495-129445517 AGACAGTCCCCAGAATCTAGAGG - Intronic
1105939556 13:25135234-25135256 AATAAGACCTCAGAATGTGGTGG - Intergenic
1108212720 13:48154709-48154731 AGTGAGCTCCCATGATGTGGTGG - Intergenic
1112197895 13:97243313-97243335 AGTGAGTAGCCAGCATGTGTCGG + Intronic
1112482601 13:99790797-99790819 AGGGAATCCCCAGAATGGTGGGG - Intronic
1114756951 14:25270000-25270022 TGTGAGTTCCCAGAGTGTGACGG - Intergenic
1120969370 14:90194393-90194415 AGTGAGCCCCCTGAAGGTGGGGG - Intergenic
1121781614 14:96625607-96625629 AGAGAGTCCCCAGAGAGTGTGGG - Intergenic
1122276417 14:100592984-100593006 AGGGACTCCCCAGAAGGAGGAGG - Intergenic
1124512089 15:30336233-30336255 AGTGAGTGCCCTGAAAGTGCTGG - Intergenic
1124730825 15:32194518-32194540 AGTGAGTGCCCTGAAAGTGCTGG + Intergenic
1125410054 15:39396578-39396600 AGTGAGTTCCAAGATTGGGGTGG + Intergenic
1128442248 15:67722038-67722060 AGTGAGTACTGATAATGTGGAGG + Intronic
1128442780 15:67728563-67728585 AATGATTCCCCAGTTTGTGGGGG + Intronic
1129303704 15:74642763-74642785 AGAGAGCCCTCAGAATGAGGGGG - Intronic
1131711434 15:95060165-95060187 TGTGAGTTCCCAAAATGTGAGGG - Intergenic
1132623483 16:879228-879250 AGTGGATCCCAGGAATGTGGGGG + Intronic
1133368489 16:5229769-5229791 AGTGATTCCCCAGAAAGTTCTGG + Intergenic
1133693833 16:8241772-8241794 TGAGGGTCCCCAGAAGGTGGGGG + Intergenic
1134023095 16:10934834-10934856 AGCGAGTCCCCAGATGGTGCTGG - Intronic
1135828390 16:25750997-25751019 AGGGAGTCCCCATTGTGTGGTGG + Intronic
1135974995 16:27102861-27102883 AGTGAGACCACAGTACGTGGTGG + Intergenic
1136084031 16:27871580-27871602 AGTGAGCCCCCTGATTGTGCTGG + Intronic
1136518217 16:30780600-30780622 GGTGAGACCTGAGAATGTGGTGG + Exonic
1136620464 16:31424959-31424981 AGTGAGAACTCAGACTGTGGAGG + Intronic
1137566461 16:49535750-49535772 AGTGGATCCCCAGGATGTAGTGG - Intronic
1137980220 16:53063080-53063102 AGTAAGTACCCAGTAAGTGGTGG - Intronic
1138846862 16:60577672-60577694 AGAGAGTCAGCAAAATGTGGTGG - Intergenic
1139221258 16:65184676-65184698 AGTGATTCCCCAGAGCCTGGAGG - Intergenic
1139961782 16:70722121-70722143 AGTGAGTCCCAGGAGAGTGGGGG - Intronic
1141615703 16:85208259-85208281 AGTGCATCCCCAGCATGTGGTGG - Intergenic
1141722863 16:85766478-85766500 AGTGAGTTCCCCGAACGTCGCGG + Intergenic
1141766525 16:86063235-86063257 AGTGATGCCTCAGCATGTGGCGG + Intergenic
1148494886 17:48047869-48047891 AGTGAGACCCGAGAATGCTGAGG - Intergenic
1152487423 17:80603277-80603299 AGTGAGAGCTCAGAATGAGGAGG + Intronic
1155304992 18:24470159-24470181 AAAGAGTCTCCAAAATGTGGAGG + Intronic
1161158449 19:2747674-2747696 AGTGAGTAGCGGGAATGTGGGGG + Intergenic
1163454669 19:17399426-17399448 AGGAAATCCACAGAATGTGGAGG + Intergenic
1164456883 19:28415719-28415741 CATGAGAACCCAGAATGTGGAGG - Intergenic
1164698296 19:30263084-30263106 AGTGAGCCCCGAGAAGGAGGTGG + Intronic
1166717058 19:44975248-44975270 AATGAGGCCCCAGAATGGGCTGG - Intronic
1168519288 19:57035729-57035751 GGAGAATCCCCAGGATGTGGGGG + Intergenic
925668623 2:6288854-6288876 AGTATGTCCCCAGCAAGTGGAGG + Intergenic
937287069 2:120760415-120760437 AGTGATTTCCCAGGAAGTGGAGG + Intronic
940704356 2:157085158-157085180 ATTAAGTTCCCAGTATGTGGAGG - Intergenic
940766140 2:157791506-157791528 CGTGAGAGGCCAGAATGTGGAGG - Intronic
941248499 2:163131759-163131781 AATGTGTCCCCAAAATGTGTTGG + Intergenic
942132915 2:172898464-172898486 AGTGGGTCCACAGAGTGAGGTGG - Intronic
942668388 2:178347258-178347280 TGTGAGTCCTCAGAGTGTTGAGG + Intronic
1169061067 20:2660675-2660697 GGTGAGGCCCCAGAAACTGGGGG - Exonic
1169183817 20:3594734-3594756 GGTCAGTCCCCAAAATGAGGAGG + Intronic
1170330122 20:15200219-15200241 AGTGAATTCCCAGAGGGTGGGGG - Intronic
1171257393 20:23700534-23700556 AGTGATATCCCAGAATGTGAGGG + Intergenic
1171778406 20:29393483-29393505 AGTGAGTCCCCAGGAGCTGCTGG + Intergenic
1171987785 20:31672573-31672595 ACTGAGCCCCCAGACTGTTGGGG - Intronic
1172495913 20:35384099-35384121 AGCCAGTCCCGAGCATGTGGTGG - Exonic
1173862477 20:46293229-46293251 TCTGAGTCCACAGAATGTGTGGG - Intronic
1174216278 20:48919111-48919133 AGCAAGACCCCAGAATGTAGTGG + Intergenic
1177359983 21:20055729-20055751 AGTGAGAAACCAAAATGTGGAGG - Intergenic
1178318280 21:31585369-31585391 ACTGTGTCTCCAGAATCTGGGGG - Intergenic
1179146626 21:38774112-38774134 AATAAGTCCCCGGAATTTGGGGG + Intergenic
1180132502 21:45835577-45835599 TGTGAGTGCCCAGAATGCTGAGG - Intronic
1182582700 22:31324431-31324453 AGGGTGACCCTAGAATGTGGAGG - Intergenic
1183058797 22:35322880-35322902 AGTGAGACCCTTGAATGTGGAGG - Intronic
1183268193 22:36843982-36844004 TGGGAGTCCCCAGAGTGTGTTGG + Intergenic
1184503389 22:44887265-44887287 AGTGTGGCCCCTGAGTGTGGTGG - Intronic
1184689165 22:46109700-46109722 AGTGAGTCTTCAGGGTGTGGAGG - Intronic
954421149 3:50419669-50419691 AGTGAGTATGCAGGATGTGGCGG + Intronic
958866349 3:99506041-99506063 GGTGATTCCCCAGACTGAGGAGG - Intergenic
961041568 3:123682124-123682146 AGTGAGTGACCAGAAAGTGGGGG + Intronic
961781294 3:129321951-129321973 ACAGAGGCCCCAGAATCTGGTGG + Intergenic
962627359 3:137239173-137239195 TGTCAGTCCCCAGAATGTGAAGG + Intergenic
967246285 3:187490628-187490650 TGTGAGTCCCCAAAGTGTGAGGG + Intergenic
967322102 3:188204805-188204827 AGTGACACCCAAGACTGTGGAGG - Intronic
968137081 3:196227407-196227429 AGTGGTTCCTCAGAGTGTGGGGG + Intronic
971637071 4:29074391-29074413 AATGAGTGCCTAGAATGTGTTGG + Intergenic
974485866 4:62505245-62505267 AGTGAGTCTCCAGAAAAAGGTGG - Intergenic
975623101 4:76314552-76314574 TGTGAGTTCCCAAAGTGTGGAGG + Intronic
975717149 4:77216150-77216172 AGTGGGTCCACAGCAGGTGGTGG + Intronic
978310435 4:107380644-107380666 AGTGAGCCTCCAGAAAGAGGGGG + Intergenic
978663473 4:111154805-111154827 AGTCAGTGCCCAAAATCTGGAGG + Intergenic
983954372 4:173680027-173680049 AGTGAGTACCAAGTAAGTGGTGG - Intergenic
985514836 5:336240-336262 AGTGACTCCCCAGTATGAGAGGG - Intronic
996324694 5:122259166-122259188 AGTGTGTCCCAAGAGTGAGGGGG + Intergenic
1001585526 5:172831601-172831623 AGTGCATCCCCAGCATGTGCAGG + Intergenic
1003058501 6:2843377-2843399 AGTGCTGCACCAGAATGTGGGGG + Intergenic
1004381312 6:15135058-15135080 AGTGAGTCCCCAGCAAGTGGAGG - Intergenic
1006280328 6:33047443-33047465 TGTGAGTGCCCAAACTGTGGAGG - Intergenic
1007186854 6:39979019-39979041 ACTGTGTCCCCAGAGTCTGGTGG - Intergenic
1007373932 6:41443644-41443666 AGAGAGACCCCCGAAAGTGGAGG - Intergenic
1007377855 6:41468692-41468714 ACAGAGTCCCCAGGAAGTGGAGG - Intergenic
1009760195 6:67995465-67995487 AGTGGGTCCACTGAATGTGTAGG + Intergenic
1013288273 6:108698883-108698905 AGTAAATGCCCAGAATGTGCTGG + Intergenic
1018250376 6:161863822-161863844 AGTGAGTCCCATGAATGTTTTGG + Intronic
1022042131 7:26591199-26591221 AATGAGTTTCTAGAATGTGGCGG - Intergenic
1022816939 7:33923016-33923038 AGTGAGTCCCAAGATGGTTGTGG + Intronic
1024272854 7:47655565-47655587 AGAGAGTCCACAGAATGTCAAGG + Intronic
1026859617 7:73777281-73777303 AGTGTGTCACCTGAGTGTGGAGG + Intergenic
1027674396 7:81141618-81141640 AGTGAGTGCCAAGGCTGTGGAGG - Intergenic
1027710346 7:81593068-81593090 AGAGAGTACCCAGAAAGTGAGGG - Intergenic
1028328023 7:89550426-89550448 TGTGAGTCTCCAGAGTGTGAGGG - Intergenic
1034493086 7:151404770-151404792 AGCGAGTCCCCAGGGTGTGCAGG - Intronic
1037435304 8:18856364-18856386 ACTGAGTGCCCAGTATGTGCTGG + Intronic
1038441512 8:27573964-27573986 ACTGAGTCCCCAAAAGTTGGAGG - Intergenic
1039100961 8:33941651-33941673 ACTGTGTCCCCAGAATGAGTGGG - Intergenic
1040286406 8:46102730-46102752 AGTGAGACCTCAGAAAATGGTGG - Intergenic
1040570478 8:48605032-48605054 AGAGAGTCCCCAGCATCTGGAGG + Intergenic
1043960862 8:86416970-86416992 AGTGAGTCCCCAGAATGTGGTGG - Intronic
1043973411 8:86558323-86558345 AGAGATTCCCCAGCAGGTGGTGG + Exonic
1045551289 8:103174919-103174941 AATGATGCCCCAGAATTTGGGGG - Intronic
1045646764 8:104307008-104307030 ATTGTGTCCTCAAAATGTGGGGG - Intergenic
1046681121 8:117171355-117171377 AGTCAGCCCCAAGAATGTCGTGG - Intronic
1046952972 8:120035521-120035543 AGGGAGTCCACAGAATCTTGTGG + Intronic
1049453612 8:142675992-142676014 TGTGGGGCCCCAGAAGGTGGTGG + Intronic
1053265495 9:36710099-36710121 AGTGAGGCCCCAGGAGTTGGTGG - Intergenic
1054839014 9:69715391-69715413 AATGAGTCCTCACAATGTGCAGG + Intronic
1056623822 9:88237559-88237581 AATCAGTCCCCAGAATGAGTAGG - Intergenic
1056954542 9:91071805-91071827 AGTGAGTCACCAGCTTGTGGGGG + Intergenic
1059073632 9:111166358-111166380 AGTAAGACCCCAGAATGGTGGGG - Intergenic
1060560780 9:124540865-124540887 AGAGAGTATCCAAAATGTGGTGG - Intronic
1061434695 9:130553867-130553889 AGGGAGGCCCCAGGATGTGCTGG + Intergenic
1062449479 9:136609482-136609504 AGTGGGTCCCCAAAAAGTGCGGG - Intergenic
1186411008 X:9344265-9344287 AGGACATCCCCAGAATGTGGCGG - Intergenic
1188627590 X:32305750-32305772 TGTGAGTGTCCAGATTGTGGAGG - Intronic
1190711530 X:53075104-53075126 AGTGAGTCAGGGGAATGTGGTGG - Intronic
1193617566 X:83709002-83709024 TGTGAGTCCCCAGAGTGTGAGGG - Intergenic
1197050157 X:122047397-122047419 TGTGAGTCCCCAGAGTGTGAGGG - Intergenic
1199597041 X:149514328-149514350 AGTGACACCCCAGAATTTTGTGG + Intronic
1199942985 X:152642357-152642379 AGTGAGGCCTCTGCATGTGGAGG - Intronic
1200094003 X:153648824-153648846 AGTGGGACCCCAAGATGTGGGGG - Intronic
1200094975 X:153654269-153654291 AGTGATACAGCAGAATGTGGAGG + Intergenic
1202174574 Y:22085603-22085625 AGTGGGTACCCCGAATCTGGAGG - Intronic
1202216786 Y:22500779-22500801 AGTGTGTACCCCGAATCTGGAGG + Intronic
1202326401 Y:23695291-23695313 AGTGTGTACCCCGAATCTGGAGG - Intergenic
1202544371 Y:25974763-25974785 AGTGGGTACCCCGAATCTGGAGG + Intergenic