ID: 1043963104

View in Genome Browser
Species Human (GRCh38)
Location 8:86440524-86440546
Sequence ATAAGGTTCTTACAAGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043963104 Original CRISPR ATAAGGTTCTTACAAGGGGC TGG (reversed) Intronic
900033829 1:390638-390660 ATCACGTTCTTAAAAGGGTCTGG - Intergenic
900054664 1:620528-620550 ATCACGTTCTTAAAAGGGTCTGG - Intergenic
902131436 1:14264615-14264637 AGAAGGTCCTTACAAGATGCTGG + Intergenic
903122996 1:21228459-21228481 CTGAGGTTCTTACAAAGAGCAGG + Intronic
903406556 1:23102159-23102181 AGAAGGTTTTTACAAAGGGAAGG + Intronic
904789233 1:33006114-33006136 ATTAGATTCTCACAAGGAGCGGG + Intergenic
905383779 1:37584626-37584648 AGAATGTTGTTACCAGGGGCTGG + Intronic
906215541 1:44036137-44036159 ATAAGCCTCTTACCATGGGCTGG + Intergenic
908104636 1:60828713-60828735 ATAACTTTCTAACAAGGGGTGGG - Intergenic
909837869 1:80280186-80280208 GTCAGTTTCTTACAAGTGGCAGG + Intergenic
909883783 1:80914282-80914304 TTAAGGGTATTACAAGGGGCTGG - Intergenic
912456470 1:109801705-109801727 ATAACTTTCTTACAAGCAGCTGG + Intergenic
912681953 1:111734438-111734460 AGAAGGTTATTACAAGAGTCAGG - Intronic
912828833 1:112931771-112931793 ATAAGATTTTAATAAGGGGCAGG + Intronic
912986706 1:114440606-114440628 ATAAAGTTTTTAAAAGGGGGAGG + Intronic
913175644 1:116270635-116270657 ATAAGGTCCTTACCTGGGACTGG + Intergenic
914240922 1:145852362-145852384 ATAAGGTTCTTTTCAGGGCCTGG - Intronic
916271277 1:162944863-162944885 ATAAATTTCTTAGAAGGGGAAGG - Intergenic
920403126 1:205689678-205689700 AAAAGGGTCAAACAAGGGGCAGG + Intergenic
920901893 1:210116929-210116951 AAAAGATTCTTAGTAGGGGCAGG - Intronic
922256185 1:223894794-223894816 ATCAGGTTCTTAAAAGGGTCTGG - Intergenic
924120319 1:240790741-240790763 AAAAGATTCTTGCAATGGGCTGG + Intronic
924337391 1:242997660-242997682 ATCAGGTTCTTAAAAGGATCTGG - Intergenic
1068878982 10:62028662-62028684 ATAAAGCTCTTAGAAGGGGCTGG + Intronic
1070747528 10:78943570-78943592 ATAAGGTTCTTATAAGAGGGAGG - Intergenic
1071802105 10:89074964-89074986 ATAAGGTTGGGACAAGAGGCAGG + Intergenic
1072017968 10:91368627-91368649 ATAGTGTTATTACAAGGGTCTGG + Intergenic
1076440636 10:130479162-130479184 CTGAGGTTTTTACTAGGGGCTGG - Intergenic
1077987455 11:7367902-7367924 ACAAGGCTCTTAGAAGGGCCTGG - Intronic
1084232821 11:67765599-67765621 ATAATGTACTTCCAAGGGGCAGG - Intergenic
1086759127 11:90604970-90604992 ATAAATTTCTCACACGGGGCAGG + Intergenic
1088141807 11:106625833-106625855 ATAAGGTTCTTATAAGAGGAAGG - Intergenic
1088726778 11:112645649-112645671 TTAAGATACTTAGAAGGGGCTGG + Intergenic
1089146062 11:116330460-116330482 TCAAGCTTCATACAAGGGGCTGG + Intergenic
1090135729 11:124197642-124197664 GAAAGGTTGTTACTAGGGGCAGG - Intergenic
1090485386 11:127107970-127107992 ATTAGATTCTTATAAGGAGCAGG - Intergenic
1094412403 12:30180642-30180664 ATAATGTTCTTACAAGGAACAGG - Intergenic
1097823340 12:64149645-64149667 CTAAGATTCTTACAGGGTGCAGG - Exonic
1099022327 12:77422093-77422115 ATAAGGAGCCTACAAGGAGCTGG - Intergenic
1102096584 12:110246152-110246174 ATAAGGTTCTTACAGGAAGAAGG - Intergenic
1105459365 13:20569013-20569035 AAAAGGTTATTAAAAGGGCCAGG - Intronic
1108566378 13:51702484-51702506 ATAAGCTTCTTAAAGGGGGCTGG + Intronic
1112195634 13:97223676-97223698 ATAAGGTTTTTAAAAAAGGCAGG + Intronic
1113609828 13:111636429-111636451 ATAAGGTTTTTGCAAGGCTCAGG - Intronic
1117766333 14:59087225-59087247 ATAAGGTTCTTCCTGGGGGTAGG - Intergenic
1118637828 14:67764095-67764117 ATAAGGTTTTTACAAGCATCAGG - Intronic
1120023602 14:79556932-79556954 ATTAGGTTTTTGCAGGGGGCAGG - Intronic
1123789927 15:23710237-23710259 CTAAGGTTCTTTCAAGGGTCTGG + Intergenic
1124898793 15:33802995-33803017 ATAAGCTGCAGACAAGGGGCTGG + Intronic
1127122414 15:55783026-55783048 AAAAGGTTTTTCCAAGGGGGAGG + Intergenic
1127532206 15:59854461-59854483 ATAAGGTTTTTAAATGGGCCCGG - Intergenic
1129141360 15:73601101-73601123 ACAAGGTTCATACATAGGGCAGG + Intronic
1138499039 16:57427228-57427250 CTCAGGATCTTACAAGGTGCCGG + Intergenic
1150657382 17:67048548-67048570 ATAAGGGGCATACATGGGGCAGG + Intronic
1151636767 17:75354531-75354553 ATTAGATTCTTACAAGGAGCGGG - Intronic
1153218308 18:2840298-2840320 ATTAGGTTCTTACAAGCCTCTGG - Intergenic
1157212170 18:45752897-45752919 ATAACATTCTGACAAGTGGCTGG - Intergenic
1157380460 18:47210247-47210269 ACAAGGTTGTTATCAGGGGCTGG + Intergenic
926374746 2:12215359-12215381 ATTAGATTCTCACAAGGAGCAGG - Intergenic
928666642 2:33556541-33556563 ATAAGATTATTAGAAGAGGCCGG - Intronic
931904341 2:66826107-66826129 ATAAAGTGCTTACAAGTGTCTGG - Intergenic
932075516 2:68659260-68659282 ATCAGAGTCTTACAAAGGGCAGG + Intergenic
934036307 2:88091546-88091568 TTAAGATACTAACAAGGGGCAGG + Intronic
939728173 2:145749806-145749828 ATACAGTTCTTGCAAGGGGTAGG + Intergenic
940009777 2:149040520-149040542 ATAAGATTGCTATAAGGGGCCGG - Intronic
940646067 2:156394086-156394108 ATTAGATTCTTATAAGGAGCCGG + Intergenic
942570647 2:177310732-177310754 ATGACATTCTTCCAAGGGGCAGG + Intronic
944786598 2:203077113-203077135 ATAAAGACCTGACAAGGGGCCGG + Intronic
945415289 2:209563418-209563440 ATAAGGTGCTTACTAAGGACAGG - Intronic
945511169 2:210704555-210704577 ATAAGGTTCTCATAAGGTGGGGG + Intergenic
947370500 2:229440657-229440679 AAATGGTTCTTACTTGGGGCTGG - Intronic
1170291405 20:14773388-14773410 AAAAGGTGGTTACCAGGGGCTGG - Intronic
1173458568 20:43223643-43223665 AAATGGTTGTTACCAGGGGCGGG - Intergenic
1175089835 20:56493198-56493220 ATACTGTTTTTAAAAGGGGCAGG + Intronic
1175128603 20:56771842-56771864 ATACGGTACTTACCAGGTGCAGG - Intergenic
1175553791 20:59833534-59833556 ACAAGGTTCCAACAAAGGGCGGG + Intronic
1175555978 20:59857184-59857206 ATGAGGAACTTACAAGGAGCTGG + Intergenic
1178135139 21:29618829-29618851 ATAAGAATGATACAAGGGGCCGG + Intronic
1178694488 21:34781192-34781214 ATTAGTGTCTTACAAAGGGCTGG - Intergenic
1178781734 21:35609764-35609786 TGAAGGCTCTTGCAAGGGGCTGG + Intronic
1180360515 22:11888898-11888920 ATAAGGTTCTTACTATAGGGTGG + Intergenic
1184355576 22:43977311-43977333 GTAAGGTACCTACAAGGTGCAGG + Intronic
952039609 3:29246421-29246443 ATAATGGTTTTACAGGGGGCCGG + Intergenic
954844612 3:53544688-53544710 ATATGCTTCTCACAAGGGGATGG + Intronic
954866442 3:53733567-53733589 ATAAGGTGCTCACAAGGAACAGG + Intronic
955572810 3:60326360-60326382 ATTAGGTTCTCATAAGGAGCGGG + Intronic
956706909 3:72007015-72007037 ATAAGGTTCTCACCAGTGGAGGG - Intergenic
957115990 3:76027429-76027451 ATAAGTTAATTTCAAGGGGCAGG + Intronic
957201440 3:77141286-77141308 ATAAGCCTATTACAAGGGGGGGG - Intronic
958931628 3:100213769-100213791 ATAAGGGCCTTATAAGAGGCAGG + Intergenic
961120994 3:124369785-124369807 GTAAGGTGGTTACCAGGGGCTGG - Intronic
961230536 3:125303564-125303586 ATTAGGTTCTCATAAGGAGCAGG - Intronic
961913614 3:130346627-130346649 GTAAGGTTCTTTCAAAGTGCTGG + Intronic
965517403 3:169636304-169636326 AAAAGATTCTTACTAGGGGAAGG - Intronic
1202737121 3_GL000221v1_random:14388-14410 ATAAGGTTCTTACTATAGGGTGG + Intergenic
972368645 4:38399823-38399845 ATTAGATTCTCACAAGGAGCAGG - Intergenic
976568716 4:86583876-86583898 ATCAGGATATTACAAGGGGGTGG - Intronic
979239742 4:118437648-118437670 ATCAGGTTCTTAAAAGGGTCTGG + Intergenic
992251136 5:74876846-74876868 AAAAGGTACTTCCAATGGGCAGG - Intergenic
994728311 5:103462407-103462429 CTAAGATTCTTGCAAGAGGCTGG - Intergenic
1002739991 5:181428230-181428252 ATCACGTTCTTAAAAGGGTCTGG + Intergenic
1012811365 6:103963349-103963371 ATAATGTGCTTACAATTGGCTGG - Intergenic
1013012951 6:106136209-106136231 ATAAGGTCCCTCCAAGGGCCAGG + Intergenic
1014743254 6:125170271-125170293 AAAAGGATGTGACAAGGGGCAGG + Intronic
1016463213 6:144300384-144300406 ATAAGGATATCACAAGAGGCCGG - Intronic
1019066984 6:169310786-169310808 AGAAGGTTTTTACTAGAGGCTGG + Intergenic
1019817434 7:3211450-3211472 AAAGGGTTATTACAAGGGGGAGG + Intergenic
1021585990 7:22208976-22208998 ATAAGGTTCTTTCCAGGGTGTGG + Intronic
1027842254 7:83327904-83327926 ATAAAATTCTTGGAAGGGGCTGG + Intergenic
1031399098 7:121310012-121310034 ACAAGGTCCTTACAAGAGGGAGG + Intergenic
1033020261 7:137717742-137717764 ATTAAGTTCTAACAAGGGGTTGG + Intronic
1034353945 7:150435860-150435882 TGCAGGGTCTTACAAGGGGCAGG - Intergenic
1035503019 8:104372-104394 ATCACGTTCTTAAAAGGGTCTGG - Intergenic
1036805617 8:11830613-11830635 AGAAGGTTCTGAAAAGGAGCAGG - Intronic
1037603482 8:20418489-20418511 ATAAGGTTTTTTTAAGAGGCAGG - Intergenic
1043963104 8:86440524-86440546 ATAAGGTTCTTACAAGGGGCTGG - Intronic
1046523095 8:115350609-115350631 ATAAGGTCATTATAAGGGGAGGG - Intergenic
1047420181 8:124701315-124701337 AAAAGGTTCCTGCAAGGTGCTGG + Intronic
1048369474 8:133765077-133765099 ATAAGGAACTTCCTAGGGGCTGG + Intergenic
1050261000 9:3840998-3841020 AAAAGGTTCAAACAAGGGGATGG + Intronic
1051224637 9:14886005-14886027 AGAAGGTGGTTACCAGGGGCTGG - Intronic
1051700816 9:19821728-19821750 CTAACTTTCTTACAAGGGGCAGG + Intergenic
1052643967 9:31208165-31208187 AAAGGGTCCTTACAAGAGGCAGG - Intergenic
1056217679 9:84420298-84420320 ATTTCGTTCTTACAAGAGGCTGG + Intergenic
1057928562 9:99173517-99173539 ATAATGTTCTTACAAGGGCCTGG - Intergenic
1059368104 9:113802735-113802757 ATAAAACTCTTAAAAGGGGCTGG + Intergenic
1060541031 9:124430266-124430288 ACAAGGGTCTTACAAGAGGGAGG + Intergenic
1203705845 Un_KI270742v1:44837-44859 ATAAGGTTCTTACTATAGGGTGG + Intergenic
1203605298 Un_KI270748v1:53038-53060 ATCACGTTCTTAAAAGGGTCTGG + Intergenic
1187776671 X:22767788-22767810 ATAAGGTTCTTAGACTAGGCAGG - Intergenic
1192664371 X:73072209-73072231 ATATGGTTGTTGCCAGGGGCAGG + Intergenic
1197209495 X:123817174-123817196 AGAAGGTTCTTATTGGGGGCTGG + Intergenic
1202387483 Y:24339478-24339500 ATCAGGTTCTTAAAAGGGTCTGG + Intergenic
1202483303 Y:25330650-25330672 ATCAGGTTCTTAAAAGGGTCTGG - Intergenic