ID: 1043963122

View in Genome Browser
Species Human (GRCh38)
Location 8:86440705-86440727
Sequence CTGATGTTCCTGAAGAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 397}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043963122_1043963125 -9 Left 1043963122 8:86440705-86440727 CCATTTTTCTTCAGGAACATCAG 0: 1
1: 0
2: 2
3: 36
4: 397
Right 1043963125 8:86440719-86440741 GAACATCAGTCATGGGTATGTGG 0: 1
1: 0
2: 1
3: 8
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043963122 Original CRISPR CTGATGTTCCTGAAGAAAAA TGG (reversed) Intronic
903028775 1:20448147-20448169 CTGGTGTTCCAGAAGCCAAAAGG - Intergenic
903820265 1:26096598-26096620 GTTCTGTTCCTGGAGAAAAAGGG - Intergenic
903918153 1:26779594-26779616 CTGATGGACCTCCAGAAAAACGG + Exonic
903967031 1:27097284-27097306 CTCAAGTTCCTGATGTAAAATGG - Intergenic
904574332 1:31493542-31493564 GTGATGTTCCAGAAGAAATGAGG + Intergenic
904990569 1:34589477-34589499 CAAACGTTCCTGAAGAAAATTGG + Intergenic
905046693 1:35009436-35009458 CTAATGTTTCTGAATATAAATGG - Intronic
906263608 1:44411801-44411823 TTGATTTTCCTGAATGAAAATGG + Intronic
907738090 1:57135618-57135640 TGGATTTTCTTGAAGAAAAAAGG - Intronic
907861442 1:58357532-58357554 CTGAAGTTCCTGAAGACATCAGG + Intronic
908107098 1:60856236-60856258 CTGTTGTTTCTGAAGGAGAAGGG + Intergenic
908531958 1:65042264-65042286 CTGAAGTTCCTGATAATAAACGG - Intergenic
908591199 1:65636836-65636858 CTGATGTCCGTGAATAAACAGGG - Exonic
908632212 1:66121572-66121594 CTGTTGTTCCAAAAGGAAAATGG + Intronic
908931452 1:69320892-69320914 GTGGTGTGCTTGAAGAAAAAGGG + Intergenic
910109465 1:83667290-83667312 CTGAGGTTCCCTAAGGAAAATGG + Intergenic
910445328 1:87294169-87294191 CTACTCTTCATGAAGAAAAATGG + Intergenic
910737809 1:90481298-90481320 CTGAAGTTTCTGAAGAACATTGG - Intergenic
911139733 1:94486246-94486268 CTCAAGTCCCTGATGAAAAATGG - Intronic
911407120 1:97455916-97455938 CTGAAGTTCCTGATGACAAAAGG - Intronic
913366774 1:118047895-118047917 CTCATGTTCCAGCAGACAAAAGG + Intronic
913970860 1:143415509-143415531 CTAAAGTTCTAGAAGAAAAAAGG - Intergenic
914065236 1:144241120-144241142 CTAAAGTTCTAGAAGAAAAAAGG - Intergenic
914113915 1:144725234-144725256 CTAAAGTTCTAGAAGAAAAAAGG + Intergenic
915499329 1:156304013-156304035 CTCATTTTGCTGGAGAAAAAAGG + Intergenic
916826254 1:168444805-168444827 CTGATGATTCTCAAGAAAACTGG + Intergenic
917104316 1:171477180-171477202 CTGTTGTTCATAAAGTAAAAGGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917615525 1:176739966-176739988 CATAGGTTCCTGAAGATAAACGG - Exonic
917648362 1:177050475-177050497 CTGATGTCCCTGAATAGCAAAGG - Intronic
917737842 1:177936789-177936811 CTGATGGGCCTGAAGAAACTCGG + Intronic
918261621 1:182801430-182801452 GTGAAGTTCATGGAGAAAAAAGG + Intronic
918262891 1:182812306-182812328 ATGGTGTGCCTGAAGAAATAAGG + Intronic
918645659 1:186901685-186901707 CTGATGTCCATGTAGGAAAAAGG + Intronic
919313021 1:195935795-195935817 ATGATTTCACTGAAGAAAAACGG + Intergenic
920116747 1:203626991-203627013 CTCAGGTTCCTGAAAGAAAAAGG - Exonic
920200500 1:204257217-204257239 CTGCTGGTCCTGCAGACAAACGG + Intronic
920244172 1:204575627-204575649 CTGAAGTCCCTGAAGAATGAGGG + Intergenic
922233473 1:223705773-223705795 CTCATGTGCCTGTAGAAGAAAGG + Intronic
922318977 1:224467973-224467995 CTGATTTTTTTAAAGAAAAAAGG - Intronic
922353177 1:224751936-224751958 CTGATGAACCAGAAGAAAGATGG + Intergenic
922391690 1:225150321-225150343 CTGATGTTCATGAAGGATATTGG + Intronic
922679283 1:227578353-227578375 CTGGTGTCCCTGAAGGAAATGGG - Intronic
923042205 1:230327430-230327452 CTGCTGTTTCTGAGGAAAGAAGG - Intronic
923193269 1:231641056-231641078 CTGATAGGCCTGAAGGAAAAGGG + Intronic
923346805 1:233061590-233061612 CAGATGGTCTTGAATAAAAATGG + Intronic
924104516 1:240636932-240636954 CTGATGTTCTTGTAGTACAACGG + Intergenic
1063125409 10:3132690-3132712 CTGATGTTTATGAAGAAAGAAGG + Intronic
1063161592 10:3422557-3422579 CTCATGTCCCTGAAGAAGCAGGG + Intergenic
1063334314 10:5196817-5196839 CAGATGTTGCTGAAGGAAACAGG + Exonic
1063579438 10:7292253-7292275 CTGACTTTGCTAAAGAAAAAAGG + Intronic
1063597146 10:7445759-7445781 CTGTTGTTCTAGAAGAAAAAAGG - Intergenic
1063875880 10:10477882-10477904 CTGATGTTCCCCAAGGAAAATGG + Intergenic
1063951438 10:11226878-11226900 ATGATGCTGCTGAAGAAAGATGG - Intronic
1064488188 10:15819594-15819616 CTGATGTACCTGAAGTAGGATGG - Intronic
1065283928 10:24168875-24168897 TTGATGATCCAGATGAAAAATGG - Intronic
1065372781 10:25006729-25006751 TAGATGTTACTGAAGCAAAAAGG + Intronic
1066446078 10:35485001-35485023 CTGATGTTCCAGAAGAGGAAAGG - Intronic
1066514541 10:36142693-36142715 CTGAGGTACCCGTAGAAAAATGG + Intergenic
1066750571 10:38652168-38652190 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
1066966479 10:42270944-42270966 CTGCTTTTGGTGAAGAAAAAAGG - Intergenic
1067401226 10:45975637-45975659 CTGGTGTTTGTGAGGAAAAAAGG - Intronic
1067463877 10:46479363-46479385 CTTATTTTTCTGAAGAAAATAGG + Intergenic
1067623318 10:47905288-47905310 CTTATTTTTCTGAAGAAAATAGG - Intergenic
1067869578 10:49945215-49945237 CTGGTGTTTGTGAGGAAAAAAGG - Intronic
1069261841 10:66408009-66408031 CTGAAGTTCCTGGTGTAAAATGG + Intronic
1069357126 10:67598995-67599017 CTGTTGTTCCTGAAATGAAATGG - Intronic
1070576194 10:77680906-77680928 CAGATGTTCCTGGAGATCAAGGG + Intergenic
1071545597 10:86526621-86526643 GTGAGGATCCTGAATAAAAAAGG - Intergenic
1072785081 10:98273796-98273818 CTGGTGTTGCTTAAGGAAAAAGG - Intergenic
1073520469 10:104123509-104123531 TTGATCTTGCTGAAGTAAAAAGG + Intronic
1073655004 10:105405001-105405023 CTGATTTCCCCGAAGAAGAATGG - Intergenic
1073852730 10:107639719-107639741 CTGGTCTGCCTGAATAAAAAAGG + Intergenic
1073939394 10:108677698-108677720 CTGATGTCCTTAAAAAAAAACGG + Intergenic
1074408121 10:113198533-113198555 ACAATGTTCCTGAAGAAGAAGGG + Intergenic
1074986127 10:118661519-118661541 GTGGTGTTCCTGAGGAAGAAGGG - Intergenic
1075178991 10:120193159-120193181 CTGATGTGGGTGCAGAAAAAAGG - Intergenic
1075250187 10:120861955-120861977 CTGATGCTTGAGAAGAAAAAGGG + Intronic
1076051080 10:127333625-127333647 CTTTTGTTCTTGAACAAAAAGGG - Intronic
1076134546 10:128036397-128036419 CTGTTGTTACTGAAGATGAAAGG - Intronic
1076456184 10:130598798-130598820 ATTATGTGCCTGAAAAAAAATGG - Intergenic
1076935032 10:133562493-133562515 CTGAGGTTCCTTAAAGAAAATGG + Intronic
1078102216 11:8336661-8336683 CTGGAGTGCCTGCAGAAAAAGGG - Intergenic
1079019531 11:16897708-16897730 TTTGTGTTCCTGAAGCAAAATGG - Intronic
1079265231 11:18924919-18924941 CTGATGTTCCTCAAGGATATTGG - Intergenic
1081558156 11:44186730-44186752 CAGATCATCCTCAAGAAAAAAGG - Intronic
1081565791 11:44260246-44260268 CTGATGCTCCTGCACAAAGAAGG - Intergenic
1081783158 11:45727490-45727512 CTGGTGGCCCTGAAGAAAAGGGG + Intergenic
1082734091 11:56837468-56837490 CTGAGGTGGTTGAAGAAAAAGGG - Intergenic
1083009323 11:59381218-59381240 TTGGTATTCCTGAGGAAAAAAGG - Intergenic
1083084225 11:60125815-60125837 CTCAAGTTTTTGAAGAAAAAAGG + Intergenic
1083150367 11:60788201-60788223 CTGATGTATCTGCAGTAAAAGGG - Intronic
1083443201 11:62690357-62690379 CTCTAGTTCCTGAAGAAAAGGGG - Exonic
1086935798 11:92744548-92744570 CTCATGTTCCTATAAAAAAATGG - Intronic
1087337239 11:96860112-96860134 CTGATGTTCATCAAGAATATTGG + Intergenic
1087337455 11:96862659-96862681 CTGATGTTCCTGAAAGAGATGGG - Intergenic
1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG + Intergenic
1088797222 11:113274147-113274169 CTGATGTGCAGGAAGAAAAGAGG + Intronic
1089082326 11:115787313-115787335 CTGCTGTTCTTGGAGCAAAATGG + Intergenic
1091091584 11:132776234-132776256 GTGATGTTCCTGAAAGAAACAGG - Intronic
1091162040 11:133432631-133432653 TTGAAGTTCCAGAAGAAGAAAGG - Intronic
1091526918 12:1312000-1312022 ATCATGTTCTTGAGGAAAAATGG - Intronic
1092085443 12:5754747-5754769 CTGATGTTACAGAAATAAAAAGG - Intronic
1092868608 12:12786243-12786265 CTGATGTTTCTGAAGATCCAAGG + Intronic
1092992031 12:13912313-13912335 CAGATGTTAATGAAGAAGAAAGG + Intronic
1093569715 12:20653120-20653142 CAAATGTTTCTGAGGAAAAAAGG - Intronic
1093832488 12:23780451-23780473 CTGATATGCATGAAGCAAAAAGG + Intronic
1093855054 12:24092118-24092140 CTGATGTTCTTGAGGTCAAATGG - Intergenic
1093925702 12:24906285-24906307 GTGATGTTCACTAAGAAAAAAGG + Intronic
1095600452 12:44007292-44007314 CTGATCTTCATAAAGAAAAAAGG - Intronic
1095620591 12:44248914-44248936 TTAATGGTCCCGAAGAAAAATGG + Intronic
1096037654 12:48486674-48486696 CTGTTTTTCCTGTAGAAATAAGG - Exonic
1096427308 12:51514961-51514983 CTGATCCTTCTGAAGAGAAAAGG + Exonic
1097324774 12:58264084-58264106 CTGTTGTTTCTGAAAAGAAATGG - Intergenic
1097967075 12:65592729-65592751 CTAGTGTTCCTTAAGAAGAAAGG - Intergenic
1098077148 12:66744262-66744284 CTTCTATTCCTGAAAAAAAAAGG + Intronic
1098508280 12:71281260-71281282 CTCAAGTTCCTGATGTAAAATGG - Intronic
1098672190 12:73245913-73245935 CTGATGATCTTGGAGATAAAGGG - Intergenic
1098962413 12:76752790-76752812 TTTATGTACCTCAAGAAAAAGGG - Intergenic
1099277523 12:80596454-80596476 CTGATTTTCATAAAGGAAAAAGG + Intronic
1100454027 12:94734217-94734239 CTGATATTTCTGCAGCAAAATGG + Intergenic
1100819486 12:98418065-98418087 CTGAATTTCCTGCAGGAAAAGGG - Intergenic
1101671665 12:106880995-106881017 TTCATTTTCCTGAAGAGAAAAGG - Intronic
1102103402 12:110299314-110299336 CTGATGGTGATGAAGAAAATAGG + Intronic
1103636656 12:122312799-122312821 CTGTGGTTCCTGGAGAAAAAGGG - Intronic
1103795235 12:123498757-123498779 CTGCTGTAACTGTAGAAAAAGGG + Exonic
1105975981 13:25473026-25473048 TTGATGTGACTGAAGAAAGATGG + Intronic
1106075739 13:26459466-26459488 CTAATTTCCCTGAAGAGAAAGGG + Intergenic
1106332999 13:28756341-28756363 CTCATTTTCCTGTAGAAAAGTGG + Intergenic
1106563164 13:30863790-30863812 CTGATGTACCTGAAGTGAAGGGG - Intergenic
1106819280 13:33445169-33445191 CTGCTGCTCCTGAAAAACAAAGG + Intergenic
1106981852 13:35294908-35294930 CTCAGGTTTCTGAAGAAACAGGG - Intronic
1107212917 13:37879226-37879248 CTGATGTGTCTGAAGAACAAAGG - Intergenic
1107258312 13:38457809-38457831 CTGATTTCCCTGAAGGAAAGTGG - Intergenic
1110308947 13:74023879-74023901 CTGGTGATCTTGAAGAAAAGGGG + Intronic
1110582135 13:77142997-77143019 CTGATGCTCCTCAAGGAAAGGGG - Intronic
1110771092 13:79347184-79347206 AGGATGTTCCTGGATAAAAAAGG - Intronic
1111413538 13:87909705-87909727 ATGATGTCCTTAAAGAAAAAGGG + Intergenic
1111791456 13:92861544-92861566 CAAATGTTCCTGTAGAGAAATGG - Intronic
1113227226 13:108172486-108172508 TTGATGTTCCTCAAGAATATTGG - Intergenic
1113245495 13:108390379-108390401 ATGATATACATGAAGAAAAATGG - Intergenic
1113542470 13:111119703-111119725 CTGATGTTGCATAGGAAAAAAGG + Intronic
1113772944 13:112923225-112923247 CTGAAGTTCATGGAGATAAAAGG - Intronic
1114127944 14:19752528-19752550 CTGGTGAGCCTGTAGAAAAAAGG + Intronic
1115479644 14:33848992-33849014 CTGCTGTTCCTGTAGGACAATGG - Intergenic
1116614759 14:47120514-47120536 CTTCTGTTCCTGAAGAAAATAGG - Intronic
1117240844 14:53830721-53830743 CTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1117733471 14:58746803-58746825 CTGAGGTTTCTGAACAGAAAGGG + Intergenic
1117768264 14:59106289-59106311 CTGAAGTTACAGGAGAAAAAAGG - Intergenic
1117955241 14:61117838-61117860 CTGCTGTTCCTACAGCAAAAAGG - Intergenic
1119645196 14:76342894-76342916 TTTATGTTCCAGTAGAAAAATGG + Intronic
1120270378 14:82306366-82306388 CAGATGATCCTGAGGAAAGATGG - Intergenic
1120358609 14:83465558-83465580 TTGATCTTGCTGAAGAAAGAGGG + Intergenic
1120362242 14:83519433-83519455 TTGTTCTTCCTGCAGAAAAATGG + Intergenic
1121475063 14:94191984-94192006 CTGATGCTCAGGAAAAAAAATGG - Intronic
1121592862 14:95131910-95131932 CTGATTTTATTGAAGAAAACAGG - Intronic
1121748316 14:96321259-96321281 CTGAAGTTTCTGAAGATTAATGG + Intronic
1122384278 14:101333430-101333452 CTGGTGACCCAGAAGAAAAAGGG + Intergenic
1123111479 14:105869580-105869602 CAACTGTTCTTGAAGAAAAAAGG - Intergenic
1123607516 15:22049335-22049357 CTGGTGAGCCTGTAGAAAAAAGG + Intergenic
1126765682 15:52008812-52008834 CTGGTGTCCTGGAAGAAAAATGG - Intronic
1126921987 15:53537020-53537042 CTGTTTTTCATTAAGAAAAAAGG - Intronic
1127051714 15:55090573-55090595 CTGATTTCCCTGCAGAAAAGAGG - Intergenic
1127153656 15:56105839-56105861 CTCATGTTTTTAAAGAAAAAAGG + Intronic
1127235587 15:57047696-57047718 CTGATATTCAAGAGGAAAAAAGG - Intronic
1127866251 15:63035601-63035623 CTGAAGTTCCTGAGGTAGAATGG + Intergenic
1128383102 15:67127641-67127663 CTGGAGTTCCTGAAGATGAAGGG + Intronic
1128618869 15:69132148-69132170 CTGTTTTTCATGAAGAAGAAGGG - Intergenic
1128803719 15:70514777-70514799 CAGAGATTCCTCAAGAAAAATGG + Intergenic
1128959904 15:71991499-71991521 CTGAGGTTTCTTAAGATAAAAGG - Intronic
1129269096 15:74410148-74410170 CTGGTGTTCCTGAAGACCCAGGG - Exonic
1130756424 15:86769248-86769270 CTTATATTCCAGAATAAAAATGG - Intronic
1131478989 15:92766259-92766281 CAGATTTTCCTGTAGGAAAAAGG - Intronic
1202979751 15_KI270727v1_random:341114-341136 CTGGTGAGCCTGTAGAAAAAAGG + Intergenic
1133636607 16:7672371-7672393 CTCATAATACTGAAGAAAAAAGG - Intronic
1134182647 16:12060288-12060310 CTGAAGTCCCTGATGTAAAACGG - Intronic
1134384248 16:13757182-13757204 CAGATGTTCCTGAAGTTTAATGG - Intergenic
1136156890 16:28388984-28389006 TTGATGTTCCAGGAGTAAAAAGG - Intronic
1136206196 16:28726297-28726319 TTGATGTTCCAGGAGTAAAAAGG + Intronic
1136502895 16:30682386-30682408 AAGATACTCCTGAAGAAAAAGGG + Intergenic
1137989379 16:53137787-53137809 TTTATGTTCTTGAAGATAAATGG + Intronic
1138021406 16:53485431-53485453 CCTATGTTCCAAAAGAAAAAAGG + Intronic
1138883748 16:61049791-61049813 CTGATGTTCCTGAAAGAGACTGG - Intergenic
1140558382 16:75947725-75947747 CTGATCTTCCTGGAGGAACAGGG + Intergenic
1140634989 16:76901941-76901963 ATGATATTCCTGGAGAAACATGG + Intergenic
1142183278 16:88681996-88682018 TTCATGTTCCTGAACACAAAGGG - Intronic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1144212722 17:13028904-13028926 CTGACTTTCCCAAAGAAAAAAGG - Intergenic
1144478038 17:15605747-15605769 CTGATGTTTTCCAAGAAAAAAGG - Intronic
1144542912 17:16162425-16162447 CTGATATTCCTGAATATGAAGGG - Intronic
1147209439 17:38863392-38863414 TGAATGTTGCTGAAGAAAAAAGG + Intergenic
1148587315 17:48790318-48790340 CTGATGCTCCCAAAGAAGAAAGG - Intronic
1149153903 17:53603284-53603306 TTGATGTTCTTAAACAAAAACGG - Intergenic
1149452851 17:56763642-56763664 TTGATGGTCCTTAGGAAAAAAGG - Intergenic
1150091306 17:62328033-62328055 CTTTTGTTCCTTAAGAAATAAGG - Intergenic
1150210134 17:63437345-63437367 CTGATCTTCCTGCAGGGAAATGG - Exonic
1150501819 17:65658487-65658509 GTGATGTTCCTGCAGAGACAAGG + Intronic
1150831295 17:68521870-68521892 TTGTTGTGCCTGAAGTAAAAGGG - Intronic
1153992191 18:10410419-10410441 CTGATGTCCCTGTAAACAAACGG + Intergenic
1154975544 18:21453985-21454007 CTGATATTTCTAAAGAAAACTGG + Intronic
1156089343 18:33446843-33446865 CTCATGTTTCACAAGAAAAATGG - Intergenic
1157300626 18:46476487-46476509 CTGATTTTCCTGTAGAGAAAAGG - Intergenic
1157541003 18:48506571-48506593 TTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1157826663 18:50818496-50818518 CTGATCTTACTGAAGATACATGG + Intronic
1158604855 18:58886821-58886843 TAGTTATTCCTGAAGAAAAATGG - Intronic
1159413964 18:68119364-68119386 TTGATTTTCCTTAATAAAAAAGG + Intergenic
1160058968 18:75512210-75512232 CTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1161970271 19:7575205-7575227 TCGATGTTCCTGAAGAATATTGG + Intergenic
1163658087 19:18559558-18559580 CTGATGTTTCTCCAGGAAAAAGG - Exonic
1164453351 19:28385839-28385861 CTGCTGTTCTTGAATAAACATGG - Intergenic
1164537076 19:29093691-29093713 GGGATTTTCCTGAAGAAAAATGG - Intergenic
1166609367 19:44176386-44176408 CTGATGGTCCTGAAGATGAGAGG - Exonic
1167313309 19:48750074-48750096 GTGGTGTTCCTGAAGCAAATGGG - Exonic
1168274629 19:55270562-55270584 CTACTGTTGCTTAAGAAAAAAGG + Intronic
1168438837 19:56346006-56346028 CTGAGGTTCCTTAAAGAAAATGG - Intronic
925636995 2:5950115-5950137 CTGATTTTCCTGCAGAAGAAGGG - Intergenic
926986407 2:18629458-18629480 ATGATTTAACTGAAGAAAAAAGG + Intergenic
927670585 2:25065708-25065730 GTGAATTTCCAGAAGAAAAATGG - Intronic
928226366 2:29451757-29451779 TTGAAGTTCCTGGAGAATAAGGG + Intronic
928735534 2:34284074-34284096 GTGATTTTCCTGATGGAAAATGG + Intergenic
930207184 2:48599589-48599611 TTGCTGTTCCTGAAGAACTAGGG - Intronic
932191445 2:69744081-69744103 CTGAAGTTCCAGAATAAACAAGG + Intronic
932417860 2:71584482-71584504 CTGATGTTACTATGGAAAAAGGG - Intronic
932845790 2:75134864-75134886 CAGATGTTGATGAAGAAACAAGG + Intronic
933476019 2:82791405-82791427 GTGAGGTTCAGGAAGAAAAAAGG - Intergenic
933617173 2:84494347-84494369 CTGATTTTCAGGAAGCAAAAAGG + Intergenic
934062214 2:88305534-88305556 ATGATGTTCCTGAAGAATCCTGG + Intergenic
934175560 2:89576435-89576457 CTAAAGTTCTAGAAGAAAAAAGG - Intergenic
934285876 2:91650799-91650821 CTAAAGTTCTAGAAGAAAAAAGG - Intergenic
934313571 2:91894325-91894347 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
935866245 2:107390739-107390761 TTGTTGTAACTGAAGAAAAAGGG - Intergenic
937570965 2:123360850-123360872 CTGAAGTTGCTGATGAAAATGGG - Intergenic
937631692 2:124109196-124109218 CTGATGTCCCAGGGGAAAAAGGG + Intronic
939236457 2:139500463-139500485 TTGATGTTCCTCAAGAATATTGG - Intergenic
939477800 2:142708676-142708698 CTCATTTTCCTGATTAAAAATGG + Intergenic
939717030 2:145596811-145596833 CTGATATTCCTGAGGGCAAAGGG - Intergenic
940113087 2:150176487-150176509 CAGATGTTCCTAGAGAACAAAGG - Intergenic
941771560 2:169350841-169350863 ATCTTGTTCCTGAAGAAAGAAGG - Intronic
943262072 2:185678769-185678791 CTGAGGTTCCTTAAAGAAAATGG - Intergenic
943892024 2:193300215-193300237 CTTATCCTCCTGAAGAAAGAAGG - Intergenic
944124425 2:196277283-196277305 TTTATGTGCCTGGAGAAAAAGGG - Intronic
944610789 2:201404476-201404498 CTAATGTTCCTGAAAATACAGGG + Intronic
944710593 2:202331840-202331862 CTGAAGTCCCTGAAATAAAATGG - Intergenic
945571906 2:211478815-211478837 GTTTTGTTTCTGAAGAAAAAAGG - Intronic
946446532 2:219744823-219744845 CTGATGTAACTGAAAAAAGAGGG - Intergenic
946851812 2:223914835-223914857 CTGCTTTAGCTGAAGAAAAATGG - Intronic
1168736962 20:148975-148997 CTGAGTTTCCGGGAGAAAAAGGG + Intergenic
1170024998 20:11879464-11879486 CTGATGATCCTGATGAAAGGTGG - Intergenic
1171131317 20:22656030-22656052 CTGATCATTCTGAAGAATAAGGG - Intergenic
1172277363 20:33686810-33686832 CTGATGATCCTGAAAAGAAGAGG - Intergenic
1172993832 20:39055387-39055409 CTGATATTCCTTAAGGAAGAAGG - Intergenic
1173078301 20:39841930-39841952 CAGATGTGCTTGGAGAAAAAAGG + Intergenic
1173869727 20:46333705-46333727 CTGATGGGCCTTTAGAAAAACGG + Intergenic
1175291780 20:57880829-57880851 TTCATGTTCATGAAGAAAAAAGG - Intergenic
1175972639 20:62694497-62694519 CTGATCTTCGGGAAAAAAAAAGG - Intergenic
1176276696 20:64276098-64276120 ATGATGTTAATAAAGAAAAAAGG - Exonic
1177868712 21:26544627-26544649 CTGGTGACCCTGAAGAAACACGG + Intronic
1178158259 21:29880355-29880377 CAGATGTGCATTAAGAAAAATGG + Intronic
1178940917 21:36904873-36904895 AAAATGTTACTGAAGAAAAAAGG + Intronic
1180540311 22:16440229-16440251 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
1180656360 22:17424334-17424356 CTCATGGTCATGTAGAAAAAGGG + Intronic
1182499629 22:30736996-30737018 CAGAAGTTCCTGTGGAAAAATGG - Intronic
949843301 3:8343546-8343568 CTGGTGTTCTGGAAGAAAAATGG + Intergenic
951259266 3:20487216-20487238 CTGATGAGGCTGAAGAGAAAAGG - Intergenic
951738140 3:25890605-25890627 CTGAGATTCAGGAAGAAAAAAGG - Intergenic
951788141 3:26447259-26447281 ATGATATTCCTGAAAAAAATGGG - Intergenic
952253482 3:31676071-31676093 GAGATTTTTCTGAAGAAAAATGG - Intronic
952902910 3:38121518-38121540 CTGATGCTCCTGAAGAAAACGGG - Intronic
954739354 3:52735237-52735259 CTGATGTTTTTGAAGATAACTGG - Intronic
955963717 3:64366544-64366566 CTGAGGTTCCTTGAGAAAGAAGG - Intronic
956906653 3:73772804-73772826 CTGATGTCTCTGAAGATAAAAGG + Intergenic
960008232 3:112804040-112804062 CTGAAGGGCCTGAAGAAAATTGG - Intronic
960826768 3:121795063-121795085 CTGATTTTCCTGAATAAATATGG - Intronic
960830130 3:121837331-121837353 CTGATGTTCATGCAGATAAGGGG + Intronic
961424842 3:126836908-126836930 CTGCTCTTCCTGAGGAGAAATGG + Intronic
962092103 3:132255104-132255126 CAGATGTTGCTTAAGGAAAATGG + Intronic
963318421 3:143785791-143785813 CTGAGGGTACTGAAGAATAAAGG + Intronic
965154167 3:165025377-165025399 CTGGTGTTCCTGAGGAAGAAGGG + Intronic
965241392 3:166203663-166203685 CTGATGTTACAGATGTAAAAGGG + Intergenic
968244546 3:197130027-197130049 AACATGTTGCTGAAGAAAAAAGG + Intronic
969341803 4:6546810-6546832 CTGGTGGTCCTTATGAAAAAGGG + Intronic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
972247291 4:37258847-37258869 CTAATTTTCCAAAAGAAAAATGG - Intronic
972262290 4:37421393-37421415 CTGATATTTCTAAAGAATAATGG + Intronic
972687609 4:41366181-41366203 CTGATGTTGCTGATGATAAAAGG + Intronic
973897566 4:55430090-55430112 CTGGGGTTCTTGAATAAAAATGG - Exonic
974425865 4:61742801-61742823 CTGATTTCCCTGAAAACAAATGG + Intronic
974529206 4:63085280-63085302 CTGACATTCCTGAGGAAGAAGGG - Intergenic
974650944 4:64753648-64753670 CTTATTTTCCTGAACATAAAAGG - Intergenic
975578751 4:75888366-75888388 CTGATATTCGTGAGGGAAAATGG + Intronic
976311801 4:83620542-83620564 CTGGTGTTCTTGTAAAAAAAAGG - Intergenic
976350195 4:84051982-84052004 CCGTTGTTCCTTAGGAAAAAAGG + Intergenic
976764417 4:88584341-88584363 CTGATGTTTCTGAGGGTAAATGG - Intronic
976962973 4:91002365-91002387 CTGGTATTCCTGAGGAAGAAGGG - Intronic
977828423 4:101560881-101560903 ATGATCTTTCTGAAGAAGAAAGG + Intronic
977945773 4:102912376-102912398 CTGCTTTTGGTGAAGAAAAAAGG + Intronic
978424320 4:108566371-108566393 CTGAAGTTCTTCAATAAAAAAGG + Intergenic
978822611 4:112983123-112983145 TTTATTATCCTGAAGAAAAACGG + Intronic
981594417 4:146402991-146403013 CTCATTTTCCTGAAGAGAAAAGG - Intronic
981786497 4:148485321-148485343 CTGATGGTCCTGAAAATATAGGG + Intergenic
982423722 4:155230313-155230335 CTGATTTTTTTAAAGAAAAAAGG - Intergenic
982485718 4:155963244-155963266 CTGAATTTCATGAAGAACAAAGG - Intergenic
982717341 4:158822740-158822762 CTTAGGTTGCTGAAGCAAAAAGG - Intronic
983240340 4:165224734-165224756 CAGGTATACCTGAAGAAAAAGGG - Intronic
984031341 4:174607574-174607596 CTGGGGTTCCTTAAGGAAAATGG + Intergenic
984734062 4:183094474-183094496 CTGATCTCCTTGAAGAAACAAGG + Intergenic
984956748 4:185052870-185052892 TTGATGGTCCAGAAGAAGAAAGG + Intergenic
984994480 4:185415715-185415737 CTGTTGCTCCAGAAGAAACATGG - Exonic
985013285 4:185606353-185606375 TTTATGGTCCTGAAGAAAAATGG + Intronic
985562785 5:599809-599831 CTGGTGAAGCTGAAGAAAAAAGG - Intergenic
985565964 5:617516-617538 CTCATGTTACTGAAAGAAAAGGG - Intronic
986315729 5:6585149-6585171 CTGGTGTCCCTACAGAAAAAGGG + Intergenic
986384368 5:7217173-7217195 CTCTTGTTTCTGAAAAAAAATGG - Intergenic
986429042 5:7663655-7663677 CTGGTCTTCCAGAAGAAACAAGG - Intronic
987242855 5:16018752-16018774 CAAATATTCCTAAAGAAAAAAGG + Intergenic
987548384 5:19344224-19344246 CTGAAATTACTGAAGAAACAAGG - Intergenic
988421493 5:31010958-31010980 CTAATGTTACAGAAAAAAAAGGG - Intergenic
989053510 5:37344568-37344590 CTGATATAACTGGAGAAAAATGG + Intronic
989618132 5:43357664-43357686 CTGATGTTCCTGAAAGAAAGGGG + Intergenic
990020324 5:51118657-51118679 CTGGTGAGCCTGAAGAGAAAAGG + Intergenic
991952259 5:71957693-71957715 CTTAAGTTCCTGAAACAAAATGG + Intergenic
992762482 5:79962843-79962865 CAGATTGTCCTGAAGAAACATGG + Intergenic
995634830 5:114175555-114175577 CTGAAGATCCTGAAAAAAACAGG + Intergenic
995960752 5:117836134-117836156 CTGATGTGGCTGAAGCAAAATGG + Intergenic
995982902 5:118128266-118128288 AAAATGTACCTGAAGAAAAATGG - Intergenic
996186179 5:120477974-120477996 CTGATGATTATTAAGAAAAAAGG - Intronic
996427345 5:123329258-123329280 TTGGTGTTCCTGAGGAAGAAGGG - Intergenic
996516080 5:124371016-124371038 ATGATGTTCCAGAAAAAAATAGG - Intergenic
996819640 5:127612297-127612319 CTGATGTTCCTTAAGAAAAGGGG - Intergenic
997019114 5:129976066-129976088 CTGATCTTCTTGAATAAAACTGG - Intronic
997182992 5:131851860-131851882 CTAAAGTTCCTGATGTAAAATGG - Intronic
997994834 5:138577093-138577115 CAGATCTTCCTGAAGAGATAGGG - Intergenic
999048633 5:148497135-148497157 CTAAAGTTCCTTAAAAAAAATGG - Intronic
1000732399 5:164852406-164852428 GTGATTTTCGAGAAGAAAAATGG - Intergenic
1001558162 5:172650322-172650344 CTGAAGTTCCTGCAGAGACATGG - Intronic
1001695967 5:173670215-173670237 CTGAAGCTCCTGAAGATAATGGG - Intergenic
1006524875 6:34595603-34595625 CTGAAATTCCTAATGAAAAAAGG + Intronic
1008283097 6:49619293-49619315 ATGACCTTCCTGAAGAAATATGG - Exonic
1008370068 6:50721890-50721912 ATGATGTTCTTGAAGAAATATGG + Intronic
1008373749 6:50767628-50767650 TTGATGATACTGATGAAAAAGGG - Intronic
1008650605 6:53557412-53557434 CTGGGGTTCCTTAAGGAAAATGG + Intronic
1008736721 6:54553718-54553740 CTGATGAAGCTGCAGAAAAAAGG + Intergenic
1009392106 6:63156666-63156688 TTGGTGTTCCTGAAAAAGAAGGG + Intergenic
1010287331 6:74094330-74094352 CTTATGTGCCTGATAAAAAATGG - Intergenic
1010706140 6:79113176-79113198 CTTATGTTCTGGAAGCAAAAAGG - Intergenic
1011055068 6:83195086-83195108 CTAATGTTGCTGGAGATAAATGG - Intronic
1011755123 6:90490950-90490972 CTGAACTTCCTGAATAGAAAAGG - Intergenic
1013942723 6:115684293-115684315 CTAATGTTCTTGAAGAAGATAGG - Intergenic
1014651487 6:124044414-124044436 CTGATCATCCTGAAGTAAACTGG - Intronic
1015628033 6:135202222-135202244 CTGATTTTCCTTAAGACATAAGG - Intronic
1015826229 6:137315065-137315087 ATGAGATTCCTGAAGAAACAGGG - Intergenic
1016176069 6:141078881-141078903 TTGGTGTTCCTGAGGAATAATGG + Intergenic
1016314442 6:142770880-142770902 CTGATGCTCCTGAATAACATGGG + Exonic
1016351616 6:143175417-143175439 TTGGTGTTCCTGAAGAAGAAGGG - Intronic
1016887030 6:148968116-148968138 CTTATGTTCCTGAAGGGTAAAGG + Intronic
1017984653 6:159433090-159433112 TTAATGTTGCTGAAGAGAAAAGG + Intergenic
1018283702 6:162215255-162215277 CTGGTGTTGATGAATAAAAACGG + Intronic
1018592735 6:165444502-165444524 TTGAAGTTTCTGAAGCAAAATGG - Intronic
1019133706 6:169895504-169895526 CTGAGGTTCCTGGAGGAAGAAGG - Intergenic
1019660032 7:2219128-2219150 CTGATGTTCCTGGAGCAGAATGG - Intronic
1020077834 7:5270245-5270267 ATGAAGTTCATGAAGACAAACGG - Intergenic
1022123340 7:27331626-27331648 CTGGAGTTTCTGAAGAAAGAAGG - Intergenic
1023590072 7:41772170-41772192 CTGATGCTGTTAAAGAAAAAAGG + Intergenic
1024689202 7:51780865-51780887 CAGCTGTCCCTGAAGACAAAAGG + Intergenic
1027435257 7:78157862-78157884 CAGCTTTTCATGAAGAAAAAGGG + Intronic
1027484114 7:78738668-78738690 AGGATGTTCATGATGAAAAAAGG + Intronic
1027657473 7:80948409-80948431 CTGATGCTTCTCTAGAAAAATGG - Intergenic
1028053441 7:86212654-86212676 ATGATTTTCCAGAAAAAAAATGG + Intergenic
1028360573 7:89962158-89962180 CTCAAGTTCCTGATGTAAAATGG - Intergenic
1028944821 7:96565674-96565696 CTAATTTTACTGATGAAAAAAGG + Intronic
1030518981 7:110573539-110573561 TTGATGTTACTGAAGAGCAAAGG + Intergenic
1031930863 7:127684536-127684558 TTGAAGTTCCTGAATAAGAAGGG - Intronic
1032801942 7:135323965-135323987 CTGCTGTTCCTCAGGAAAGAAGG + Intergenic
1033879849 7:145867908-145867930 TTGATGTTCCAGAAGATGAAAGG - Intergenic
1034074373 7:148217664-148217686 CTGATATTCATGGAGAGAAATGG - Intronic
1034416436 7:150966974-150966996 CTAAAGTTTATGAAGAAAAAGGG + Intronic
1034604439 7:152298496-152298518 CTAAAGTTCTAGAAGAAAAAAGG + Intronic
1034855965 7:154547567-154547589 CTTTTGTTCCTGAACTAAAAGGG - Intronic
1035421333 7:158731193-158731215 CTTATGTGCCTGAAAAAGAAGGG + Exonic
1035440925 7:158899077-158899099 CTCAAGTTCCTTAAGTAAAATGG + Intronic
1037231187 8:16660808-16660830 ATAATATTCCTGAACAAAAATGG + Intergenic
1037385546 8:18336500-18336522 CTGATGTTCCTCAAGGAAGGTGG - Intergenic
1039792688 8:40888183-40888205 CTGATGTTTCTGGAGAAGGAGGG - Intronic
1040882482 8:52221785-52221807 CTGTAGTTCCTGGGGAAAAATGG + Exonic
1040888266 8:52288988-52289010 CTGATGGTCATGTAGGAAAATGG - Intronic
1043292786 8:78624062-78624084 CTAATGGTACTGTAGAAAAATGG - Intergenic
1043413501 8:80024795-80024817 CTGTAGTTCCTGAAGAACAAGGG - Intronic
1043563956 8:81527287-81527309 CTAATTCTGCTGAAGAAAAAAGG + Intronic
1043963122 8:86440705-86440727 CTGATGTTCCTGAAGAAAAATGG - Intronic
1045217627 8:100164046-100164068 CTGATTTTCCTTAAAATAAAAGG + Intronic
1047028099 8:120846672-120846694 CTGATTTACCTTAAAAAAAAAGG + Intergenic
1047722984 8:127659423-127659445 CTGATTTCCCTGAAGGAAGAAGG - Intergenic
1047908609 8:129500917-129500939 CTGATATTACTGAAAATAAAAGG + Intergenic
1047986163 8:130235991-130236013 CTCACGTTACAGAAGAAAAATGG + Intronic
1048029462 8:130617462-130617484 CTGATGTCCCTGAAAGAAATGGG + Intergenic
1048137145 8:131757529-131757551 CTGATGTTCATCATGAATAAAGG + Intergenic
1048562190 8:135552309-135552331 CTGAGGTACATGGAGAAAAACGG - Intronic
1050400807 9:5251899-5251921 AACATGCTCCTGAAGAAAAATGG + Intergenic
1050984635 9:12067029-12067051 CTCATGTTCCAGAAGAATCATGG + Intergenic
1051351442 9:16201508-16201530 ATGTTGTTCCTGATGAAAAAAGG - Intergenic
1052067148 9:24036039-24036061 CAGATGTTCCTAAAAGAAAAGGG + Intergenic
1052206218 9:25844268-25844290 CTCATTATCTTGAAGAAAAAGGG + Intergenic
1052458015 9:28726234-28726256 CTCATGTTCATAAAGAAATAAGG - Intergenic
1055285555 9:74724792-74724814 CTACTGTTCATGAAGACAAATGG + Intronic
1055374564 9:75634903-75634925 ATGATGCTGCTGAAGAAAAGAGG - Intergenic
1056444707 9:86654536-86654558 CTGATGATCAAGAAAAAAAAAGG - Intergenic
1057079829 9:92164947-92164969 AAGTTGTTCCTGAAGATAAAAGG + Intergenic
1059151944 9:111956788-111956810 CCCAGGGTCCTGAAGAAAAATGG - Intergenic
1059260450 9:112971049-112971071 CTGCTTTCCCAGAAGAAAAATGG - Intergenic
1062074374 9:134576545-134576567 TTGATGCTCCTGAAGAGGAAGGG + Intergenic
1062509193 9:136895518-136895540 CTGTCCTTCCTGGAGAAAAAAGG + Intronic
1062669655 9:137700427-137700449 CTGATGTGGCTGGAGAAAAAAGG - Intronic
1185951309 X:4437498-4437520 CTGATGTTAATAATGAAAAAGGG + Intergenic
1186368480 X:8921371-8921393 CTTAAGTTCCTGAAATAAAATGG - Intergenic
1186519807 X:10195402-10195424 CTGATCATGCTGAAGAAACAAGG + Intronic
1187638390 X:21259700-21259722 CTGCTGCTCCAGAAGAAAGATGG + Intergenic
1188107288 X:26160249-26160271 ATGATGATCCAGAATAAAAACGG + Intergenic
1189900667 X:45702917-45702939 CTGATGTTGCAGAAGAAATCAGG - Intergenic
1190336455 X:49265640-49265662 ATGATGTTCCTGAAACAAGAGGG - Intergenic
1190537517 X:51444485-51444507 TCTATGTTCCTGAAGGAAAACGG - Intergenic
1191157405 X:57288679-57288701 CTGATGTCCTTTAAGAAAAATGG + Intronic
1191844503 X:65536512-65536534 GTCATGATCCTGAAGGAAAAAGG - Intergenic
1192577417 X:72254170-72254192 CCAATGTGCCTGAAGAAAAAGGG - Intronic
1192667727 X:73105443-73105465 TTAGTGTTTCTGAAGAAAAAGGG + Intergenic
1193446770 X:81615397-81615419 TTGATGTTCCTGAGGAAGAAGGG - Intergenic
1194051805 X:89078531-89078553 TTTATTTTTCTGAAGAAAAAAGG - Intergenic
1194652838 X:96535880-96535902 CTTATGAATCTGAAGAAAAAAGG - Intergenic
1194707854 X:97197218-97197240 CTCATGTGCCAAAAGAAAAATGG + Intronic
1195777701 X:108425957-108425979 CTGTTGATAATGAAGAAAAATGG - Intronic
1196161456 X:112488515-112488537 TTGTTGTTCCTGAGGAAGAAGGG + Intergenic
1197003442 X:121468024-121468046 CTGATGTTCCTTATAAAATATGG + Intergenic
1197049739 X:122043996-122044018 CTGGTGTTCCTGAAGGAGAAGGG - Intergenic
1199314654 X:146363061-146363083 CTCCTGTGCCTGAAAAAAAAGGG - Intergenic
1199380944 X:147171308-147171330 CTGAACTTCGTGAAGAAATAGGG - Intergenic
1199721053 X:150543017-150543039 GTGAAGTCCCTGTAGAAAAATGG - Intergenic
1201181486 Y:11351816-11351838 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic