ID: 1043968334

View in Genome Browser
Species Human (GRCh38)
Location 8:86504253-86504275
Sequence TAGATCCTCCAGCAGTTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043968330_1043968334 21 Left 1043968330 8:86504209-86504231 CCAGGTTTTTGCTCATTAACAGA 0: 1
1: 2
2: 1
3: 19
4: 132
Right 1043968334 8:86504253-86504275 TAGATCCTCCAGCAGTTGTGGGG 0: 1
1: 0
2: 0
3: 7
4: 113
1043968329_1043968334 22 Left 1043968329 8:86504208-86504230 CCCAGGTTTTTGCTCATTAACAG 0: 1
1: 2
2: 2
3: 15
4: 151
Right 1043968334 8:86504253-86504275 TAGATCCTCCAGCAGTTGTGGGG 0: 1
1: 0
2: 0
3: 7
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043968334 Original CRISPR TAGATCCTCCAGCAGTTGTG GGG Intronic
902803319 1:18845013-18845035 TAGATCTTTCAGCAGTTGGTTGG - Intronic
904858494 1:33517806-33517828 GAAATCCTCCAGGAGTTGTGAGG + Intronic
908525676 1:64985404-64985426 GAGATCCTCCAGTGGTTGTGGGG - Intergenic
913259792 1:116987806-116987828 TACCTGCTCCAGTAGTTGTGAGG + Exonic
915712847 1:157917774-157917796 TAGGACCTCCAGCAGTACTGCGG + Intergenic
917547069 1:175981942-175981964 TAGAAATTCTAGCAGTTGTGAGG - Intronic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
1066681326 10:37938884-37938906 TTTATTCTCCAGCGGTTGTGAGG - Intergenic
1072519969 10:96222691-96222713 TAGCTCCTCCACAGGTTGTGCGG + Intronic
1073484822 10:103810043-103810065 TAGAGGCTCCAGCAGTAGGGAGG - Intronic
1075097584 10:119482752-119482774 AAGTTCCTCCAGCAGCTGAGAGG - Intergenic
1075177357 10:120178031-120178053 TTCCTCCTCCAGCTGTTGTGAGG + Intergenic
1080648926 11:34207629-34207651 TAGTACCTCCTGCAGTTCTGGGG - Intronic
1081726465 11:45332904-45332926 TTAATCCTACAACAGTTGTGAGG - Intergenic
1082944098 11:58740033-58740055 TGGCTCCTTCAGCTGTTGTGTGG + Intergenic
1084948614 11:72652465-72652487 TAAATACTCCAGCATATGTGAGG + Intronic
1088406013 11:109480021-109480043 AAGATAATACAGCAGTTGTGTGG + Intergenic
1089629861 11:119777838-119777860 TTGATCCTCCAGCAGCTTTTGGG + Intergenic
1090746566 11:129710290-129710312 CAGATCCTCCAGCAGGTGATGGG - Intergenic
1093029834 12:14278073-14278095 TAGATGCTTCAGCAGATTTGAGG - Intergenic
1096652390 12:53068290-53068312 TAAGTACTCCAGCAGCTGTGGGG + Exonic
1097900637 12:64870214-64870236 TAAATCCTCATGCCGTTGTGTGG + Intronic
1102011640 12:109622735-109622757 GAGTTCCTCTAGCAGCTGTGGGG - Intergenic
1108647213 13:52441919-52441941 TAATTCCCCCATCAGTTGTGAGG - Intronic
1108967573 13:56328800-56328822 CAGAACTTCCAGCATTTGTGGGG + Intergenic
1118768232 14:68924424-68924446 TCGATCCTCTGCCAGTTGTGGGG - Intronic
1124054336 15:26228061-26228083 TGGATCCTACAGCAAGTGTGGGG - Intergenic
1124252041 15:28113276-28113298 GACATCCTCCCGCAGGTGTGTGG - Exonic
1125450984 15:39807096-39807118 TAGATCCACCAGCAACAGTGAGG + Exonic
1135429647 16:22372590-22372612 TAGTTTCTCCAGGATTTGTGAGG - Intronic
1135665236 16:24330121-24330143 GGGATGCTCCAGCAGATGTGAGG - Intronic
1135972194 16:27080665-27080687 TAGATCCTGAAACTGTTGTGTGG - Intergenic
1137005688 16:35272885-35272907 TTCATTCTTCAGCAGTTGTGAGG + Intergenic
1137639461 16:50015578-50015600 TAGATCCTCCTGCAGTATTGTGG - Intergenic
1138402625 16:56759719-56759741 GAGAGCCTCAAGCAGTTGTACGG - Intronic
1139936668 16:70576601-70576623 TAGGGCCTCCAGCTGTTATGAGG + Exonic
1140682502 16:77399118-77399140 TAGACCCACCACCAGGTGTGGGG + Intronic
1147341074 17:39753736-39753758 AAGTTCCTCCAGTAGATGTGTGG - Intergenic
1148317839 17:46719521-46719543 TACATACTTCAGCAGTTTTGAGG - Intronic
1150713500 17:67551368-67551390 TTTATCCTCTAGCAGTTCTGGGG + Intronic
1153829815 18:8912347-8912369 TAGGTCCTTCAGAAGTTGTTAGG - Intergenic
1155055278 18:22176949-22176971 CAGGTCCTCCAGCAGGTCTGCGG - Exonic
1156394889 18:36690539-36690561 AAGAACCTCCAGCAGTTCTTGGG - Intronic
1158572544 18:58609261-58609283 TAAATCCTCCAGTAGCTGCGTGG + Intronic
1158831326 18:61282899-61282921 TGGAACCTCCAGCTGTTGTGGGG + Intergenic
1160778568 19:867855-867877 TAAATCCTTCAGCATTTATGGGG - Intronic
1160929693 19:1564572-1564594 TGGAGCCTCCAGCAGATGGGTGG + Intronic
928342301 2:30455452-30455474 TAGATCTTCCAGAGGTGGTGTGG - Intronic
928675355 2:33645901-33645923 TAGACCCTCCACCCTTTGTGTGG + Intergenic
943738592 2:191386046-191386068 TGGATCCTGAAGCAGCTGTGAGG - Exonic
947821492 2:233074337-233074359 TGGACCCTCAAGCTGTTGTGGGG + Intronic
1168755878 20:317363-317385 TAGATGCTCCAGCCCATGTGGGG + Intergenic
1169783201 20:9331073-9331095 AAGATTCTCCAGCAGTTGCCTGG + Intronic
1173182628 20:40816233-40816255 GAGAGCCACCAGCAGTTGTTAGG - Intergenic
1173371897 20:42443963-42443985 AAGGTCATCCAGCTGTTGTGTGG - Intronic
1173838721 20:46142276-46142298 AAGATCCTCCAGCTGCCGTGTGG - Intergenic
1174570713 20:51499187-51499209 CAGATCCTCTGGCAGCTGTGTGG + Intronic
1174644107 20:52070828-52070850 TAGATTCACATGCAGTTGTGAGG - Intronic
1175922069 20:62454820-62454842 TAGACCCCCCAGCTCTTGTGGGG - Intergenic
1177876924 21:26645159-26645181 CAGAACCTCCAGCAGTTGTAAGG + Intergenic
1178585384 21:33866813-33866835 TAGCCCTTCCAGCAGTTCTGGGG + Intronic
1179148944 21:38794093-38794115 CAGATGCTCCAGCAGGAGTGAGG + Intergenic
1179158300 21:38870632-38870654 TAGATATTCTAGCAGGTGTGAGG + Intergenic
1180692318 22:17727594-17727616 TTGAACCTCCAGCAGCTGTCTGG + Exonic
1181488668 22:23247614-23247636 CAGATCCTCCATCCGTGGTGTGG - Intronic
1181589600 22:23876033-23876055 AAGATCCTCAAGCAGCTCTGTGG - Intronic
1181760039 22:25052011-25052033 CAGCTCCCCCAGCAGCTGTGTGG - Intronic
1181814472 22:25427868-25427890 TAGCTTCTCATGCAGTTGTGAGG + Intergenic
1183977220 22:41519363-41519385 TGGAACCTACAGCAGTCGTGAGG + Intronic
1184607608 22:45583064-45583086 TAGATCCTCGAGCAGCCTTGTGG + Intronic
1185025959 22:48412669-48412691 CTGAACCTCCAGCTGTTGTGTGG + Intergenic
1185188704 22:49418925-49418947 TAGAGCCTCCAGAAGGAGTGTGG - Intronic
953477307 3:43216375-43216397 CAGACTCTCCAGCTGTTGTGAGG - Intergenic
955836428 3:63060570-63060592 TATACCCTCCAGCACTGGTGGGG + Intergenic
957426333 3:80044629-80044651 TTGAGTCTCCAGCAGTTGTTGGG + Intergenic
959898914 3:111638119-111638141 TAGATCCATTGGCAGTTGTGGGG - Exonic
960555937 3:119030727-119030749 CAGATCCTCCAGATGGTGTGGGG + Intronic
961034633 3:123634045-123634067 TAGTTCCATCAGCAGATGTGTGG - Intronic
961544327 3:127621753-127621775 ATGATCCTGCAGCAGTTCTGAGG + Exonic
968253216 3:197242463-197242485 TGTATTCTCCAGCAGTTGGGTGG - Intronic
968672906 4:1861931-1861953 TAGATCCTTCTACATTTGTGGGG + Intergenic
968675111 4:1873016-1873038 TTGAACCACCATCAGTTGTGGGG - Intronic
969544153 4:7812977-7812999 TTGATCCTGCAGCAGGTGTGAGG - Intronic
973715749 4:53674250-53674272 TAGATCCTCCAGGAGTGGGCAGG - Intronic
984764382 4:183388392-183388414 CAGGTCACCCAGCAGTTGTGTGG - Intergenic
985753093 5:1694068-1694090 CAGATCCTCCAGAAGGTCTGAGG - Intergenic
987544406 5:19294106-19294128 TGGATACTGCAGCATTTGTGTGG + Intergenic
988930398 5:36031116-36031138 AAGATACTCCAGAAGGTGTGGGG + Intergenic
989291524 5:39771657-39771679 AAAACACTCCAGCAGTTGTGGGG + Intergenic
992654413 5:78894113-78894135 CAGACTCTCCAGCACTTGTGTGG - Intronic
1001067803 5:168553035-168553057 GAGATCCTTCAGCAATTGTAGGG - Exonic
1003560484 6:7175853-7175875 TACATCCTCTCGCAGGTGTGAGG - Intronic
1004613284 6:17266496-17266518 TAGAGTCTGCAGCAGCTGTGTGG - Intergenic
1013729470 6:113147169-113147191 TAGATCCAGTAGCAGGTGTGAGG + Intergenic
1017051958 6:150401711-150401733 TAGATCCTCTTGCTGTTCTGAGG + Exonic
1017812690 6:157995539-157995561 TAGATCCTGAAGCATCTGTGCGG + Intronic
1020135810 7:5587254-5587276 TAGGTCCTGGAGCAGTGGTGGGG + Intergenic
1021157352 7:17227275-17227297 TAGTTCCTGGAGCAATTGTGGGG - Intergenic
1027618292 7:80451203-80451225 TAGATCATCAAGCAGTTGTAGGG + Intronic
1030609744 7:111676241-111676263 TAGCTCCTCAAGTAGTTATGAGG + Intergenic
1032497064 7:132370407-132370429 GACATCCTCCAGCATTTGAGAGG - Intronic
1032721252 7:134552320-134552342 TTTATTCTCCGGCAGTTGTGAGG - Intronic
1036601784 8:10267682-10267704 CTGATCCCCCAGCAGGTGTGGGG - Intronic
1039194585 8:35016766-35016788 AAAATCCTCCAGCAGTTGACTGG + Intergenic
1039785277 8:40829288-40829310 TAGATCCTCCAGTGGTTGCTTGG - Intronic
1042934326 8:74043470-74043492 TAGACCATGCAGCAGTGGTGGGG + Intergenic
1043968334 8:86504253-86504275 TAGATCCTCCAGCAGTTGTGGGG + Intronic
1049522483 8:143100875-143100897 TAGATCCACATGTAGTTGTGAGG - Intergenic
1050291039 9:4155420-4155442 TAGATTCTTAGGCAGTTGTGCGG + Intronic
1052974094 9:34399175-34399197 TGGATCCACCAGCACATGTGGGG + Exonic
1054814217 9:69459390-69459412 TAAAACCTCCAGCTGTTATGTGG + Intronic
1056366993 9:85915469-85915491 TGGAGCCTCCAGCAGGAGTGTGG + Intergenic
1057540203 9:95960630-95960652 TAGAGCCTCCAGAAGGAGTGTGG + Intronic
1058874277 9:109229603-109229625 CAGCTCCTCCAGAAGGTGTGTGG - Intronic
1061861014 9:133468860-133468882 CAGAGCCTGCAGCAGCTGTGTGG + Exonic
1062711275 9:137976398-137976420 TACATCCACCAGCACTTCTGGGG + Intronic
1190532834 X:51396577-51396599 TAGTTTCTGCAGCAGGTGTGGGG + Intergenic
1190730635 X:53223404-53223426 TAGATCCTCTAGGAGGTGTTGGG - Intronic
1192151945 X:68718082-68718104 GACATCCTCCAGCACGTGTGGGG + Exonic
1194770372 X:97896412-97896434 TAAATCCTCCAGTAGTTCAGAGG + Intergenic
1197862866 X:130988601-130988623 TGGATTCTCCACCTGTTGTGAGG + Intergenic