ID: 1043968411

View in Genome Browser
Species Human (GRCh38)
Location 8:86504836-86504858
Sequence CTAAATAATAAGCAGCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 204}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043968411 Original CRISPR CTAAATAATAAGCAGCAGAG GGG (reversed) Intronic
903596434 1:24499100-24499122 GTAAATCATGAGCAGTAGAGAGG - Intergenic
904590627 1:31613510-31613532 CCCAGTAGTAAGCAGCAGAGTGG + Intergenic
908323418 1:63000250-63000272 CTAATTACTAAGTAGCAGAAGGG + Intergenic
908525598 1:64984814-64984836 CTAAATAGTAAGCAGCAGAAGGG + Intergenic
908776807 1:67648588-67648610 CTAAATCATAATCTCCAGAGTGG + Intergenic
910762823 1:90751634-90751656 CTACATAATAAACAGCATTGGGG + Intergenic
912141988 1:106741391-106741413 CTTAATAAAAAGCAGCAGAAAGG + Intergenic
912806479 1:112760459-112760481 CAAAATAAGAACCAGGAGAGAGG - Intergenic
913096519 1:115522390-115522412 CTAAACCATAAGCAGGAGAAGGG + Intergenic
917512183 1:175677813-175677835 CTAAATAATAGACAGGAAAGAGG + Intronic
917706673 1:177641760-177641782 ATAAATAGTAAGGAGGAGAGTGG + Intergenic
918451917 1:184666985-184667007 TTAAATAACAAACAGAAGAGGGG + Intergenic
923491487 1:234488018-234488040 CTAAATGATAAGCAACTGGGTGG - Intergenic
1063485934 10:6420999-6421021 CTAAATAATAATAATTAGAGAGG - Intergenic
1064604705 10:17026650-17026672 ATAAATAATAAGAATCACAGAGG + Intronic
1064780388 10:18831426-18831448 CTAAATTATAACCAGAAGATGGG - Intergenic
1064799088 10:19048582-19048604 CTAAATAAACAGCAGGGGAGAGG - Intergenic
1065718191 10:28594716-28594738 CTATACAATAATCAACAGAGAGG + Intronic
1066223887 10:33363148-33363170 AAAAATGATAAGCAGAAGAGGGG - Intergenic
1069144781 10:64877138-64877160 CTAAATAATGAACAGCAAATTGG + Intergenic
1070579545 10:77709568-77709590 ATAAAGCATAAGCACCAGAGAGG + Intergenic
1072244504 10:93530645-93530667 TTTAATAAAAAGCAACAGAGTGG - Intergenic
1078384846 11:10880513-10880535 CTAAAAAATAATCAGCAATGGGG - Intergenic
1078388501 11:10914237-10914259 GCAAATAATAAGCAGCAGGAAGG - Intergenic
1078738096 11:14039970-14039992 CTACATTATAAGCATCAGATTGG + Intronic
1082721675 11:56685110-56685132 CCAAATAATAAGCAGCTAAGTGG + Intergenic
1082776726 11:57250955-57250977 CTACAGGATAAGAAGCAGAGAGG + Intergenic
1082838510 11:57668677-57668699 CAAAATAAGTATCAGCAGAGTGG - Intronic
1087249189 11:95877001-95877023 CTAAATAATAATCACCTGAAAGG + Intronic
1092104418 12:5911268-5911290 CTACATGAAAAGCAGGAGAGAGG + Intronic
1097460209 12:59852593-59852615 TTAAATCAAAAGCAGCAGATAGG - Intergenic
1098082595 12:66804827-66804849 CATATTAATAAGCAGCAAAGTGG + Intergenic
1098758308 12:74391502-74391524 CTAAATATTAACCAGCTCAGTGG + Intergenic
1099679541 12:85807299-85807321 TTAAATAATAGGCAACAGAGGGG + Intronic
1105685080 13:22772658-22772680 ACAAATAATATGTAGCAGAGAGG - Intergenic
1107450070 13:40500310-40500332 CGAGATAACAAGCGGCAGAGGGG + Intergenic
1109651424 13:65331979-65332001 ATAAATATTAAGCATCAGAGAGG - Intergenic
1109776458 13:67047553-67047575 CAAATTCATAGGCAGCAGAGTGG - Intronic
1110215046 13:73015870-73015892 CTAAAAAAGAAGCACCTGAGTGG + Exonic
1110758290 13:79201604-79201626 CTATATAAGAAGGAGCAGGGAGG - Intergenic
1112127267 13:96481726-96481748 CTAAAAAAGAAGGAGCAGGGTGG + Intronic
1114583215 14:23784548-23784570 CTAAAGAGTAAGCAGTAGATGGG + Intergenic
1116075739 14:40108487-40108509 CTGCAGGATAAGCAGCAGAGAGG - Intergenic
1116608413 14:47033176-47033198 CTAATTAAGAAGCAGGAGAAAGG + Intronic
1118141979 14:63093791-63093813 AAAAATAACAAGGAGCAGAGAGG - Intronic
1119121716 14:72085551-72085573 CAAGATAATAAGCATCAGAAGGG + Intronic
1121585876 14:95062472-95062494 ATAAAGAAACAGCAGCAGAGGGG - Intergenic
1122648157 14:103208454-103208476 CTGAAAAATAAGAAGCAAAGAGG - Intergenic
1123167484 14:106340016-106340038 TTAAAGAATAAGCAGGTGAGGGG + Intergenic
1123170100 14:106364729-106364751 TTAAAGAATAAGCAGGTGAGGGG + Intergenic
1123221390 14:106860029-106860051 TTAAAGAATAAGCAGGTGAGGGG + Intergenic
1124828388 15:33123250-33123272 GGAAAGATTAAGCAGCAGAGTGG - Intronic
1125488543 15:40129196-40129218 CTAAATATTAAAAGGCAGAGAGG - Intergenic
1126755746 15:51923383-51923405 CTCAAAAAGAAGCAGCAGAAGGG + Intronic
1127244315 15:57155065-57155087 TTAGATAATAAGCAACAAAGTGG + Intronic
1128479732 15:68026827-68026849 CTGAATATTGAGGAGCAGAGAGG + Intergenic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1133210383 16:4260344-4260366 CTTTATATTAAGAAGCAGAGAGG + Intronic
1134249398 16:12563802-12563824 ATAAATAAAAAGCAGCAAATGGG - Intronic
1135132502 16:19864461-19864483 CTTACTAATAAGCAGCAGGTGGG + Intronic
1135905490 16:26508053-26508075 CTACAGAATAACCAGCAGATAGG + Intergenic
1138874622 16:60934660-60934682 ATAAATAATAAAGAGCAGAGTGG + Intergenic
1140294284 16:73693385-73693407 ATAAATAATAAACAGCAAACAGG - Intergenic
1143556068 17:7661390-7661412 GTAAATAATAAGCAACAGAATGG - Intergenic
1143786053 17:9256552-9256574 CAAAATAATATGCAGGAGACAGG - Intronic
1146556844 17:33832366-33832388 CTAAATCATTAACAGCAGACAGG + Intronic
1148359381 17:46999251-46999273 TTAATAAATAAGCTGCAGAGAGG - Intronic
1149736385 17:58997832-58997854 CTAAATTTTAGGTAGCAGAGAGG - Intronic
1152810724 17:82380874-82380896 CAAAAAAAAAAGCAGCAGAAAGG + Intergenic
1152946069 17:83198110-83198132 TAAAATAATAAGCAGCAGACTGG - Intergenic
1156244650 18:35285843-35285865 GGAAATAATAAGGAACAGAGTGG + Intronic
1156329420 18:36105630-36105652 TTTAAGAATGAGCAGCAGAGGGG - Intergenic
1157713929 18:49869493-49869515 CTAAGTCAACAGCAGCAGAGTGG + Intronic
1158095900 18:53770440-53770462 CTAAAAAATTCTCAGCAGAGTGG + Intergenic
1158904226 18:61996280-61996302 CTAAACAAAAAGCAGCGGAGAGG + Intergenic
1160140580 18:76318156-76318178 ATAAATAAAAAGCAGTAAAGAGG + Intergenic
1163347368 19:16752013-16752035 AAAAATAACAAGCAGCAGAGAGG + Intronic
1167823382 19:51950072-51950094 CTAAATAAAAATCAGAAGTGTGG - Intergenic
926106974 2:10158720-10158742 TTCAATAATAAGCAGCCAAGCGG + Intronic
927034267 2:19156995-19157017 TTAAATGATAAGCTGCAGACTGG - Intergenic
927875111 2:26650099-26650121 CTGCAGAATGAGCAGCAGAGAGG + Intergenic
928792815 2:34979122-34979144 CTAAATAATGAGCAGGATATGGG + Intergenic
929046729 2:37797578-37797600 TTAACTAATAAGTAGCAGAGAGG - Intergenic
929180994 2:39038976-39038998 TTAAATAATAAGCAACAATGGGG - Intronic
929311926 2:40435480-40435502 CAAAGTATTAAACAGCAGAGAGG - Intronic
933394714 2:81716448-81716470 CAAAAGAATCATCAGCAGAGAGG + Intergenic
933498478 2:83081956-83081978 CTAGATAATAAGCAGCAAAATGG - Intergenic
934945610 2:98539097-98539119 CACAATGATAAGCAGCAGAGAGG - Intronic
935533938 2:104270940-104270962 CTAGACAATAGGCAACAGAGTGG + Intergenic
935609400 2:105005343-105005365 CTGAATACAAGGCAGCAGAGGGG - Intergenic
936240360 2:110783020-110783042 CTTAATAATGAGGAGCAGGGAGG + Intronic
936276519 2:111102425-111102447 GTAACTAATAAGCACAAGAGAGG + Intronic
936449426 2:112622603-112622625 ATAGATATTTAGCAGCAGAGAGG - Intergenic
940443667 2:153750818-153750840 ATAAATAATAAAGATCAGAGCGG - Intergenic
940658664 2:156519892-156519914 CTAAGTATTAAGCAGCTCAGTGG + Intronic
941624798 2:167819795-167819817 GTAAATAAGAACCAGGAGAGAGG - Intergenic
941731730 2:168925263-168925285 CAAGCTAGTAAGCAGCAGAGTGG - Intronic
942307872 2:174626655-174626677 AAAAATAATAAGCAAAAGAGAGG - Intronic
943402880 2:187437852-187437874 TTAAATCATAAGCAGCACACTGG - Intronic
944481802 2:200164725-200164747 CTAAATAAAAAACAGGAGATGGG + Intergenic
945478984 2:210322262-210322284 CTAAGTAATAACCAGAGGAGGGG - Intergenic
946093289 2:217249616-217249638 CTTAACAAAAAGCAGAAGAGAGG - Intergenic
947411025 2:229839742-229839764 CTGAATAATTAGCAGCGGAATGG + Intronic
947971274 2:234327470-234327492 TTAAATGATAAACAGGAGAGAGG + Intergenic
1172234461 20:33361059-33361081 ATAAATAATAACCAGCAAATTGG + Intronic
1174769044 20:53281252-53281274 CTAAATAATGAGAAGCAGCCAGG + Intronic
1176990202 21:15486766-15486788 CTAAATTATAGGGAGAAGAGAGG + Intergenic
1177316956 21:19474803-19474825 CTAAATAGTAAGCAAGAGAAAGG + Intergenic
1177411232 21:20732983-20733005 ATAAATAATAACAAACAGAGAGG - Intergenic
1177861362 21:26458466-26458488 AAAAATAATAAGTAGGAGAGTGG + Intergenic
1177900079 21:26904154-26904176 CTATATAATATGTAGCACAGAGG - Intergenic
1178846433 21:36177677-36177699 CTAAATAAGAAGAGGAAGAGAGG + Intronic
1179247154 21:39643867-39643889 CTACAAAATAAGCCACAGAGGGG - Intronic
1180223363 21:46374225-46374247 CTAAACAATCAGGAGGAGAGGGG - Intronic
1181905050 22:26187636-26187658 ATACAGAAAAAGCAGCAGAGAGG + Intronic
1182162476 22:28136921-28136943 TTAAATCATAAGCAACACAGAGG + Intronic
1182653605 22:31872156-31872178 CTTAATACTCAGCAGCTGAGTGG - Intronic
1183025388 22:35061902-35061924 CAAAATAATAAGCTAGAGAGAGG - Intergenic
1183229199 22:36570363-36570385 CTAAATAATGACCACCAGCGGGG + Intronic
953127658 3:40107459-40107481 CTTAATAGGAATCAGCAGAGGGG + Intronic
955306971 3:57843614-57843636 TTAAATGATAAGAAACAGAGAGG + Intronic
955438345 3:58928713-58928735 CTAAACAATAAGAAACAGATAGG - Intronic
960105470 3:113791210-113791232 CTAAATAAAAAGGAGTAGAGAGG - Intronic
960320393 3:116227753-116227775 TTAAATAATAAACAGAAGAATGG + Intronic
960417966 3:117408550-117408572 CCAAATAATAAGCCGTAGACAGG - Intergenic
962819581 3:139035396-139035418 CTAAATAATAGGCTGCAGTTTGG + Intronic
963416828 3:145006857-145006879 CTAAATAAATATCATCAGAGTGG + Intergenic
966036213 3:175419526-175419548 CTAAATAATATGCAGTATACTGG - Intronic
966554174 3:181240449-181240471 CTAAATTATAATCAGAAGACTGG - Intergenic
968935287 4:3607109-3607131 ATAAATAAGCAGAAGCAGAGAGG - Intergenic
970271039 4:14347912-14347934 ATAAGTAATGAGAAGCAGAGGGG + Intergenic
970999981 4:22311142-22311164 CAAAGAAATAAGAAGCAGAGAGG + Intergenic
971059457 4:22951292-22951314 CCAAATAAACAGCACCAGAGAGG + Intergenic
981047581 4:140279520-140279542 CTAAATAATAAGTACTAGATTGG + Intronic
981478419 4:145211149-145211171 CTTAATAATGAGCAGCAAAAAGG + Intergenic
984222870 4:177000059-177000081 GTAAATAAAAAGCAGAATAGGGG - Intergenic
984223501 4:177006257-177006279 GTAAATAAAAAGCAGAATAGGGG - Intergenic
988047915 5:25982278-25982300 CTAAAAAATAAGCTACAGATTGG - Intergenic
992471725 5:77063321-77063343 CAAAAGAATCAGCAGCACAGGGG + Exonic
993240062 5:85370936-85370958 TAAAATAATTAGCAGAAGAGAGG + Intergenic
993981661 5:94549900-94549922 AGAAATAATAAACATCAGAGTGG + Intronic
994929856 5:106167516-106167538 TTAAATAATAAGCAGTTGAAAGG + Intergenic
994955391 5:106524893-106524915 CTAACTAATAACCACCTGAGGGG - Intergenic
994998205 5:107092687-107092709 CTAAGTAATATGCAGTGGAGTGG + Intergenic
995279365 5:110316194-110316216 CTGAATAACAAGCATCAGAATGG - Intronic
995497493 5:112762403-112762425 CTAAATAATAGCCTGCAGACTGG + Intronic
998994617 5:147857309-147857331 CTAAATATTCAGCAGTATAGGGG - Intergenic
999226762 5:150032005-150032027 CTATCTAATCAGCAGAAGAGAGG - Intronic
999347479 5:150836961-150836983 CTAAAAAAAAAGCTGCAGGGTGG - Intergenic
999965518 5:156805551-156805573 CTAATAAATAAGAACCAGAGGGG + Intergenic
1000787843 5:165568682-165568704 GTAATTAAGAAGCAGCACAGAGG - Intergenic
1001545677 5:172569199-172569221 ATAAATACTTAGCAGGAGAGAGG + Intergenic
1004789556 6:19009288-19009310 TTAAATAATAAGAATAAGAGGGG - Intergenic
1005646806 6:27847084-27847106 CTATGTAATAACCAGGAGAGAGG - Intronic
1009297236 6:61967475-61967497 GAAAATAAGAAGCAGCAGGGTGG + Intronic
1010060118 6:71613180-71613202 TTGAATAAAAAGCATCAGAGAGG - Intergenic
1011908190 6:92400012-92400034 CTGAAAAATAAGCAGCATATTGG - Intergenic
1012182590 6:96173144-96173166 CTGAAGAAAAATCAGCAGAGAGG - Intronic
1012330992 6:97987301-97987323 ATAAATAATAAGGAGCAAATGGG - Intergenic
1013196943 6:107852362-107852384 CTAAACAAAAAGCAGCAAATTGG - Intergenic
1013954739 6:115827946-115827968 ATAATTAATAAAAAGCAGAGTGG - Intergenic
1014483875 6:121975228-121975250 CAAAATAATCAGCAACAGAAAGG - Intergenic
1014758793 6:125331535-125331557 CAAAATAATCAGCATGAGAGTGG - Intergenic
1014778911 6:125541147-125541169 AGAAAAAATAAGCAGCAGATTGG - Intergenic
1016023732 6:139262463-139262485 CTAAATATTAATCAGTTGAGAGG + Intronic
1017879436 6:158549552-158549574 CTAAATAACAAACAAGAGAGCGG + Intronic
1018433194 6:163739424-163739446 CCAAATAATTACCAGCAGAATGG + Intergenic
1019002322 6:168764483-168764505 ATAAATTTTAAGCAGCAAAGTGG - Intergenic
1022552880 7:31258537-31258559 CTAAAAAATTATCAGCACAGTGG - Intergenic
1022996204 7:35757935-35757957 ATAAATAATTTGCATCAGAGAGG + Intergenic
1024816855 7:53281779-53281801 CTAAATCATAAGGAGGAGGGTGG - Intergenic
1026195838 7:68172842-68172864 CTAAAAAAAAAAAAGCAGAGTGG + Intergenic
1026428688 7:70322601-70322623 TTAAATACTCACCAGCAGAGAGG - Intronic
1027409151 7:77895432-77895454 GCAAATAAAGAGCAGCAGAGAGG + Intronic
1028220341 7:88189587-88189609 CTTAATTAAAAGTAGCAGAGTGG + Intronic
1030185752 7:106760069-106760091 CTAAATAAAAGGCAGCACTGCGG + Intergenic
1032929349 7:136648481-136648503 TTAAATAATAAGCATCAGTCAGG - Intergenic
1033639930 7:143252810-143252832 GGAAATAACAAACAGCAGAGTGG + Intronic
1037330100 8:17735903-17735925 ATAAATGCAAAGCAGCAGAGAGG + Intronic
1038127809 8:24693741-24693763 CTAAAGAATGAGCAGGTGAGGGG + Intergenic
1038512246 8:28149677-28149699 ATAAATAATAAGAATTAGAGTGG - Intronic
1038678432 8:29644578-29644600 CTAAATAAATAGTAGCAGAAAGG + Intergenic
1039277656 8:35951588-35951610 CTAAATAATACTGAGGAGAGAGG + Intergenic
1039407065 8:37322337-37322359 CTATATAAAAAGCAGGAAAGTGG - Intergenic
1040695048 8:49986533-49986555 TTAAATAATAAACATCTGAGTGG + Intronic
1041857566 8:62475834-62475856 CTAACTAATATGAAGCACAGTGG + Intronic
1043868204 8:85399782-85399804 CAAAGTACTAAGCAGCATAGAGG + Intronic
1043968411 8:86504836-86504858 CTAAATAATAAGCAGCAGAGGGG - Intronic
1045886597 8:107105955-107105977 CTAAATGCTAACCAGCAGATGGG - Intergenic
1046022848 8:108687339-108687361 TTAAAAAACAAGCAGCAGACTGG + Intronic
1046800277 8:118418749-118418771 TTAAATAAAAAGCAGAAGAAAGG + Intronic
1047550562 8:125868027-125868049 GAAGATAATAAGCAACAGAGTGG - Intergenic
1047894798 8:129354582-129354604 CTATATAAGAGGCAGCAGTGTGG - Intergenic
1051173791 9:14344901-14344923 TTAAATAACCAGCAGAAGAGGGG + Intronic
1051496246 9:17726673-17726695 CTATAAAATAGGAAGCAGAGAGG + Intronic
1052807762 9:33027495-33027517 CTAAAAAATAGCCAACAGAGTGG + Intronic
1054454897 9:65424793-65424815 ATAAATAAGCAGAAGCAGAGAGG + Intergenic
1054708897 9:68491157-68491179 CTAGATTTTAAGCAGCAGACAGG - Intronic
1054984682 9:71247757-71247779 CTAATGACTAAGCAGCAGAAAGG - Intronic
1057466967 9:95323166-95323188 CTAAGTAGGAAGCAGGAGAGAGG - Intergenic
1058708442 9:107657280-107657302 CTCAATAAGAATCAGCAGTGGGG + Intergenic
1059793123 9:117662376-117662398 CTATTTAATAAGAAGCTGAGTGG + Intergenic
1060409098 9:123388397-123388419 AAAAATAAAAAGCAGCAGAGGGG - Intronic
1186806271 X:13143232-13143254 CTAAAAAACACACAGCAGAGGGG - Intergenic
1187795154 X:22995520-22995542 CTAAAGAAGTAGCAGCAGTGTGG - Intergenic
1187821915 X:23296928-23296950 CTAATTAACAAGGAGGAGAGAGG - Intergenic
1188708351 X:33363243-33363265 AAAAATAATAAGCAGAAGAGAGG + Intergenic
1191668911 X:63731024-63731046 TTTAATAAGAAGCAGCAGAAGGG + Intronic
1193750583 X:85338291-85338313 CTACATATTAAGCAGAACAGAGG + Intronic
1195001696 X:100648928-100648950 CCAGCTAGTAAGCAGCAGAGTGG - Intronic
1195450422 X:105005607-105005629 CTATAATATAAGCAGAAGAGGGG - Intronic
1196026762 X:111049474-111049496 TAAATTAATTAGCAGCAGAGTGG + Intronic
1196490370 X:116258506-116258528 CTGAATAATAATCATCAAAGAGG + Intergenic
1196646004 X:118117575-118117597 ATAAATAGTAAGTGGCAGAGCGG + Intergenic
1197810737 X:130440836-130440858 ATAAATAATAAAGATCAGAGCGG - Intergenic
1198329319 X:135607138-135607160 CTAGATACTGAGCATCAGAGGGG + Intergenic
1198329568 X:135609460-135609482 CTAGATAGTGAGCATCAGAGGGG + Intergenic
1198337226 X:135678442-135678464 CTAGATACTGAGCATCAGAGGGG - Intergenic
1198362356 X:135908002-135908024 CTAGATAGTGAGCATCAGAGGGG + Intronic
1198362584 X:135910331-135910353 CTAGATACTGAGCATCAGAGGGG + Intronic
1198580215 X:138055495-138055517 CTAGAGAATAATCAGCACAGAGG + Intergenic