ID: 1043968507

View in Genome Browser
Species Human (GRCh38)
Location 8:86505451-86505473
Sequence ATATGAGTGTGGAAGGCAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043968504_1043968507 5 Left 1043968504 8:86505423-86505445 CCTCAGACTTATCAGGAAGAAGA 0: 1
1: 0
2: 4
3: 30
4: 335
Right 1043968507 8:86505451-86505473 ATATGAGTGTGGAAGGCAGACGG No data
1043968501_1043968507 11 Left 1043968501 8:86505417-86505439 CCCCAACCTCAGACTTATCAGGA 0: 1
1: 3
2: 3
3: 23
4: 176
Right 1043968507 8:86505451-86505473 ATATGAGTGTGGAAGGCAGACGG No data
1043968502_1043968507 10 Left 1043968502 8:86505418-86505440 CCCAACCTCAGACTTATCAGGAA 0: 1
1: 2
2: 1
3: 16
4: 190
Right 1043968507 8:86505451-86505473 ATATGAGTGTGGAAGGCAGACGG No data
1043968503_1043968507 9 Left 1043968503 8:86505419-86505441 CCAACCTCAGACTTATCAGGAAG 0: 1
1: 2
2: 4
3: 13
4: 186
Right 1043968507 8:86505451-86505473 ATATGAGTGTGGAAGGCAGACGG No data
1043968499_1043968507 12 Left 1043968499 8:86505416-86505438 CCCCCAACCTCAGACTTATCAGG 0: 1
1: 1
2: 2
3: 20
4: 340
Right 1043968507 8:86505451-86505473 ATATGAGTGTGGAAGGCAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043968507 Original CRISPR ATATGAGTGTGGAAGGCAGA CGG Intronic
No off target data available for this crispr