ID: 1043970446

View in Genome Browser
Species Human (GRCh38)
Location 8:86522863-86522885
Sequence GTGTCCTAAAACAATTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 146}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043970446 Original CRISPR GTGTCCTAAAACAATTGTGA AGG (reversed) Intronic
902860936 1:19245117-19245139 GTGTCCTAAAATGAATGTGATGG - Intronic
909685205 1:78340107-78340129 GTGTCCTCAAACAATTAAAATGG + Intronic
913353873 1:117896347-117896369 GTCTTCTAAAGCAATTTTGAAGG - Intronic
914742313 1:150475208-150475230 GAGTCCTAAGACATTTGTTAGGG + Intronic
920750142 1:208666569-208666591 GTGACGGACAACAATTGTGAAGG - Intergenic
921809534 1:219496919-219496941 GAGTCCAAAAGCAAGTGTGAGGG + Intergenic
922941908 1:229474270-229474292 GTGGCTTAAAACAATTCTGTGGG - Intronic
1064536382 10:16361558-16361580 GTGGCCTAAAACAATGGAAATGG - Intergenic
1068070395 10:52186691-52186713 ATGTCTTAAAACATTTTTGATGG - Intronic
1069184969 10:65411036-65411058 GTGACCTAAACCAATCCTGAAGG - Intergenic
1071319725 10:84442224-84442246 GTGTCCTAAAAAGATGGTGGGGG + Intronic
1071387419 10:85135997-85136019 GTGTCCTAAATCAATCTTGGTGG + Intergenic
1072463244 10:95639477-95639499 TTGTATTAAAACAATGGTGAGGG - Intronic
1072516380 10:96187365-96187387 GTGTCTTAAGACCATTTTGAAGG + Intronic
1073554018 10:104430144-104430166 GTGTCTTTTAACTATTGTGAAGG - Intronic
1073983655 10:109183419-109183441 GTGTCCAAAAACAAATGAGTGGG - Intergenic
1074383799 10:113001305-113001327 GTGCCCTAAAAGAATTTTTAAGG - Intronic
1078405064 11:11063406-11063428 GTGTGCTAAACCATTCGTGAAGG + Intergenic
1082219430 11:49616357-49616379 GTGTAGTAAAACAATTTTGCAGG + Intergenic
1086630201 11:89008419-89008441 GTGTGGTAAAACAATTTTGCAGG - Intronic
1086646992 11:89234762-89234784 GTGTCCCAAAACAATTACCATGG + Intronic
1087770614 11:102205846-102205868 CTGTCCTAAAAAACTAGTGAAGG - Intronic
1088330438 11:108645445-108645467 ATGTCCTAAAACCATGGTGATGG - Intergenic
1088546765 11:110966954-110966976 GTGGCCTAAGATAATTTTGATGG - Intergenic
1089032934 11:115352215-115352237 GTTTCATAACAAAATTGTGACGG + Intronic
1089629608 11:119776106-119776128 GTGTCCTAGGGCAATTGTGCCGG - Intergenic
1093818939 12:23587591-23587613 GTGTCATAAAAATTTTGTGAGGG - Intronic
1095370074 12:41456578-41456600 TTGGCCTAAAACAAGTGTTAGGG + Intronic
1099149140 12:79087073-79087095 GTGTACTAACACAGCTGTGAAGG - Intronic
1109389322 13:61671732-61671754 CAGTACTAAAACAATTGTTATGG - Intergenic
1110533751 13:76627370-76627392 GAGTCCTAAGACAGTTGTGGTGG - Intergenic
1110726354 13:78829125-78829147 GTTTTCTATATCAATTGTGAGGG + Intergenic
1114018247 14:18451957-18451979 GTGTTCCAGAATAATTGTGAGGG + Intergenic
1114023114 14:18499168-18499190 GTGTTCTGGAATAATTGTGAGGG - Intergenic
1115228079 14:31125902-31125924 GTATTCCAAAACAATTGGGATGG + Intronic
1115618256 14:35116852-35116874 GTGTCTAAGCACAATTGTGAAGG - Intronic
1117827739 14:59721060-59721082 CTGTCCTAAAATATTTGGGAGGG - Intronic
1118124213 14:62881879-62881901 GTCTCCTAAAATAACTTTGATGG + Intronic
1124076104 15:26445856-26445878 TTGTCCTTAAACAATTTAGAGGG - Intergenic
1126871741 15:52996665-52996687 GAATCCTAAAACATTTGTGCTGG + Intergenic
1128889143 15:71315342-71315364 GTGTCATAATAAAAGTGTGAAGG - Intronic
1129628509 15:77231992-77232014 ATGACCCAAAGCAATTGTGAAGG + Intronic
1130771722 15:86930861-86930883 GTGGCTTAAAACAATAGTCAAGG + Intronic
1133554394 16:6891062-6891084 GTGTCAACAAACAATTGTGAAGG - Intronic
1133662059 16:7927795-7927817 GTCTCCAAAGACAATTGTGAAGG - Intergenic
1133805808 16:9125332-9125354 GTTTCCTAAAACACTTCAGAAGG + Intergenic
1135696884 16:24596072-24596094 GATTCCTAACAAAATTGTGAAGG - Intergenic
1137366319 16:47862708-47862730 GGGTCCTGAATCAATTTTGAAGG + Intergenic
1137743313 16:50802087-50802109 GTTTTCTAAAGCAATTGTAATGG - Intergenic
1143006943 17:3843147-3843169 GTGTCCTAACACAAAGGGGAAGG + Exonic
1148398801 17:47335288-47335310 GTTTTCTAAAACAATAGAGAAGG + Exonic
1151546121 17:74794236-74794258 GGGTCCTGAAACAAGTCTGATGG + Intronic
1156062093 18:33091244-33091266 GTGTCCTCAAACCATTTTGCAGG - Intronic
1158065119 18:53397777-53397799 GTGTCTTTGAACAATTGTCATGG + Intronic
1158619033 18:59014806-59014828 GAGTCCTCAAGCAATAGTGAAGG + Intergenic
1159180608 18:64897891-64897913 GTGTTCCAAAACAATTATAATGG + Intergenic
1159366206 18:67468813-67468835 ATTGCCTAAAACAACTGTGAGGG + Intergenic
1160397064 18:78580296-78580318 TAGTCCTAAAACAACAGTGAGGG + Intergenic
1164800926 19:31075973-31075995 GTTTTCTAAAACAGTTGTGGGGG - Intergenic
928044474 2:27915062-27915084 GTGTCCTAAAGCAAATCTAATGG - Intronic
928792076 2:34969516-34969538 GTGTCCTAAATCAATTACAATGG + Intergenic
932950198 2:76283968-76283990 GTGTCCTAATACAATTTATAGGG + Intergenic
933073464 2:77891839-77891861 GTGGCCTAAAACAATAGTGAAGG - Intergenic
935485535 2:103648635-103648657 GTGTCCCAAAACATTTGCAATGG - Intergenic
936147313 2:109988582-109988604 ATGTTCTAAAACGATGGTGATGG - Intergenic
936197379 2:110382901-110382923 ATGTTCTAAAACGATGGTGATGG + Intergenic
936614389 2:114033680-114033702 GAGTACTAAAACAGTTGTTATGG - Intergenic
939159795 2:138574410-138574432 AAGTCCTAAAAAAATTGTGATGG + Intergenic
939279890 2:140049731-140049753 GTGTCCTTAAACAAACCTGATGG - Intergenic
939348935 2:141006402-141006424 GTATCCTTTAACAATTGTAAAGG + Intronic
940338341 2:152552433-152552455 TTGTCCTAAAAAAATTGTTCTGG + Intronic
941156466 2:161984659-161984681 GGCTCCTTAAAGAATTGTGAGGG - Exonic
942917788 2:181332937-181332959 GTGTAGTAAAAAAATTGTCATGG - Intergenic
943215302 2:185026047-185026069 CTGCCCTAAAAAAATTGAGATGG - Intergenic
943541188 2:189216796-189216818 GTGTCCAAAGACAATGTTGAGGG - Intergenic
943935411 2:193908930-193908952 GTGTACTTAAACAACTGAGATGG + Intergenic
945573067 2:211494849-211494871 GTTTCCTAAAACAATTCCCAAGG - Intronic
947555422 2:231088575-231088597 GTGTCCCAAAACAACTACGATGG - Intronic
1169159788 20:3367712-3367734 ATGCCCCAAAACAATTCTGATGG + Intronic
1169349823 20:4859140-4859162 GTTTTCTAAAACAGTTGTGATGG - Intronic
1169996930 20:11568711-11568733 GTCTCCTACACTAATTGTGATGG - Intergenic
1175658034 20:60789042-60789064 GTTTCCTATAACAACTCTGAGGG - Intergenic
1180442761 22:15382828-15382850 GTGTTCCAGAATAATTGTGAGGG + Intergenic
1180447218 22:15426124-15426146 GTGTTCTGGAATAATTGTGAGGG - Intergenic
954538787 3:51380380-51380402 GTGTCCTGCAGCAAATGTGATGG + Intronic
955469576 3:59272591-59272613 GTGTGCGAAAACAATTTTTAGGG - Intergenic
955689141 3:61573524-61573546 ATGTACTAAAACAAGGGTGAAGG - Intronic
957823160 3:85405238-85405260 GTATCCTAGAACAGTTTTGATGG + Intronic
959628213 3:108477770-108477792 GTTTCATAAAACAATTTTGTGGG - Intronic
959728491 3:109573270-109573292 GTGTCCAAGAAAATTTGTGAGGG + Intergenic
959805078 3:110541281-110541303 GTAGCCTAAAACAATAGTCAAGG - Intergenic
960782505 3:121335096-121335118 GTATCCTAAAACATTGCTGAAGG - Intronic
961476792 3:127151810-127151832 GTGTCCTTAAACAACTTAGATGG + Intergenic
963468019 3:145707499-145707521 GATTCTTTAAACAATTGTGATGG - Intergenic
964076933 3:152703167-152703189 ATGTCCCAAAACAATTGCAATGG + Intergenic
965305155 3:167055300-167055322 TTGTCCTTAAGCAAATGTGAAGG + Intergenic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
975665583 4:76731987-76732009 CTCTCCTAAACCACTTGTGAGGG - Intronic
977258856 4:94772901-94772923 GTTTCATAATACAATTATGAAGG - Intronic
979018106 4:115460471-115460493 ATTTTCTAAAACAATTGTGATGG - Intergenic
979072363 4:116224149-116224171 GTGTGATAAAACAACTGTAATGG + Intergenic
979160796 4:117458685-117458707 GGGTCATAAAACAATTGTGAAGG + Intergenic
979973816 4:127170769-127170791 GTGCCCCAAAACAGTTATGATGG - Intergenic
983432463 4:167668960-167668982 GTTTCCAGAAAAAATTGTGAGGG - Intergenic
984128317 4:175840180-175840202 ATGTCCTGAAAAAATTATGATGG - Intronic
984258613 4:177417116-177417138 GTGCCCTAAAACAATTGCAGTGG + Intergenic
985608570 5:872807-872829 GTATCCTAAAACAACAGTCAAGG + Intronic
986438021 5:7753970-7753992 AAGTTTTAAAACAATTGTGAGGG + Intronic
988013653 5:25524960-25524982 GTGTTATAAAACAACTGTTAGGG + Intergenic
989265800 5:39472162-39472184 CTTTCCTAAAACACTTTTGAAGG - Intergenic
990556007 5:56936378-56936400 GTGTACAAAAACAGTTTTGATGG - Intronic
991478779 5:67053803-67053825 GTGTATTAAAATAATAGTGATGG - Intronic
994352848 5:98767185-98767207 GTTTCCTTAAACAATAGTGGTGG - Intergenic
995736105 5:115300968-115300990 GTGTCCCAAAACAATTAAAATGG - Intergenic
996461484 5:123748893-123748915 CTGTCCTCAAACACTTGAGATGG + Intergenic
996489213 5:124072564-124072586 ATGTTCTTAAACAGTTGTGAAGG - Intergenic
999039854 5:148396543-148396565 GTGTTCTTAAAGAATTTTGAAGG - Intronic
1000703043 5:164476866-164476888 TTTTCCTAAAGCTATTGTGAGGG + Intergenic
1003579147 6:7323792-7323814 GTTTCCTAAAACAGATGTTATGG + Intronic
1008296912 6:49789671-49789693 GTGTTCAAAAACAATTCTGTAGG + Intergenic
1009555733 6:65163516-65163538 GTGTACTAGATCAATGGTGAGGG + Intronic
1009612343 6:65962738-65962760 GTGTCCAAAAATAATTCTAAAGG - Intergenic
1010283235 6:74044613-74044635 GTTACCTAACACAAATGTGAGGG + Intergenic
1011820557 6:91248322-91248344 GGGTCCTAAAAAAATTGAGAAGG + Intergenic
1012538429 6:100328318-100328340 GTGTGCTAAAACACCTGAGATGG - Intergenic
1012779611 6:103540897-103540919 GTGTACTAAAAGAAATGTGTTGG - Intergenic
1015097847 6:129437569-129437591 ATGTCCCAAAACAATTTTTATGG + Intronic
1015453633 6:133399799-133399821 GTTTCTTAAAATAATTTTGATGG + Intronic
1015990226 6:138933379-138933401 GTGTTCTAATACAATTTTTATGG + Intronic
1018656297 6:166040468-166040490 GTAGCCTAAAACAATAGTCAAGG + Intergenic
1019070160 6:169338919-169338941 CTGTAATGAAACAATTGTGATGG + Intergenic
1021706005 7:23368569-23368591 GTGTCCTAAAAATGTGGTGATGG + Intronic
1023222923 7:37938804-37938826 GGGTACTGAAACAATTGTGGCGG - Intronic
1023849677 7:44143320-44143342 GTGTCATAAAACACTTGTTATGG - Intergenic
1027177015 7:75910885-75910907 ATGTTCTCAAACAATTGTGGTGG - Intronic
1030799308 7:113829636-113829658 CTCTCCAAAAAGAATTGTGAGGG + Intergenic
1032319203 7:130869530-130869552 GTGTTCTAACTAAATTGTGAAGG + Intergenic
1034939215 7:155219415-155219437 GTTTCCTAACACTATTTTGAGGG - Intergenic
1037265505 8:17055253-17055275 GTTTCCTGAAACAATGATGAAGG + Intronic
1042007509 8:64197926-64197948 GTGACATAAAACAATGGTCATGG - Intergenic
1043970446 8:86522863-86522885 GTGTCCTAAAACAATTGTGAAGG - Intronic
1044077128 8:87835766-87835788 GAGTCATAAGACATTTGTGAGGG + Intergenic
1045632899 8:104147306-104147328 TTTTCTTAAAACAAATGTGAGGG + Intronic
1045986062 8:108251058-108251080 GTGTGGTAAATGAATTGTGAAGG + Intronic
1046737451 8:117791966-117791988 TTGTCCTAAAACAGTGGTCAGGG + Intergenic
1056196029 9:84229339-84229361 GTGGCCTAAAACAATAGCAAAGG - Intergenic
1056903161 9:90620098-90620120 GTGTTCTAAAACAGTGGTAATGG + Intronic
1058326831 9:103708887-103708909 GTCTCCTACAACAGTTGAGAGGG + Intergenic
1186597201 X:10996146-10996168 GTTTCCTAAAACTATACTGAGGG - Intergenic
1187275710 X:17815133-17815155 GTGTCCTAAAGCAAGTATCATGG + Intronic
1187307828 X:18112914-18112936 GTGTACTAAGACAATGATGATGG - Intergenic
1188541005 X:31250344-31250366 GTCTTCTAAAACAATTGCTAAGG + Intronic
1188882607 X:35507867-35507889 GTCTCCTAAATCCCTTGTGATGG - Intergenic
1190225978 X:48545220-48545242 GTATCTTAGAACCATTGTGAGGG + Intronic
1192028746 X:67486003-67486025 GTGTCCCAAAACAATTGCAATGG + Intergenic
1193893209 X:87077709-87077731 GTGTCCCAAAACACATGTGTTGG - Intergenic
1194195656 X:90888497-90888519 GTTTCCTAAGACAATTGTTGAGG - Intergenic
1197126627 X:122954579-122954601 GTGTCCTAAAACAACTGACTTGG - Intergenic
1199706419 X:150429215-150429237 GTGACCTCATACAAATGTGAGGG - Intronic