ID: 1043970896

View in Genome Browser
Species Human (GRCh38)
Location 8:86527320-86527342
Sequence CAGGGAATGAAAGGGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 381}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043970896_1043970903 -7 Left 1043970896 8:86527320-86527342 CCTGCAGCCCCTTTCATTCCCTG 0: 1
1: 0
2: 2
3: 36
4: 381
Right 1043970903 8:86527336-86527358 TTCCCTGGGTTCATGGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043970896 Original CRISPR CAGGGAATGAAAGGGGCTGC AGG (reversed) Intronic
900320233 1:2079931-2079953 CAGGGAACGAGAGGGCTTGCGGG - Intronic
900634148 1:3653363-3653385 CCGGGAAAGGCAGGGGCTGCAGG - Intronic
900694786 1:4002923-4002945 CGGGGGATGAGAGTGGCTGCTGG + Intergenic
901027279 1:6285308-6285330 CAGGGCTTGGAAGGGGCTGCTGG - Intronic
901955011 1:12777696-12777718 CCGGAAAGGAAAGGGGATGCAGG + Exonic
902741519 1:18441846-18441868 CAGGGAAAGAGAGGGCCTCCTGG + Intergenic
904320791 1:29696815-29696837 CAGGGCATGGAAGGGGATGGCGG + Intergenic
904539635 1:31224183-31224205 GAGGGAGGGAAGGGGGCTGCTGG - Intronic
905253099 1:36662396-36662418 CAAGGAATGACAAGGGCTGCTGG - Intergenic
905599929 1:39240975-39240997 CAGGGAATAAAAGTAGCAGCTGG - Intronic
905922582 1:41729228-41729250 AAGGCAGGGAAAGGGGCTGCCGG - Intronic
907817994 1:57938785-57938807 GAGGGAAGGACAGTGGCTGCAGG - Intronic
907863035 1:58372148-58372170 CAGGCAATGAAAGCAGCTGCAGG + Intronic
909601507 1:77466180-77466202 CAGCGGATGCAAAGGGCTGCAGG - Intronic
910665673 1:89723717-89723739 CAGGGAGTGAACAGGGCTCCTGG + Intronic
910774584 1:90862148-90862170 CCTGTAATGAGAGGGGCTGCTGG + Intergenic
911277434 1:95879292-95879314 CAGGCCATGAAAGCAGCTGCAGG - Intergenic
912145491 1:106789127-106789149 CAGGTAATGAAAGGGAAAGCAGG + Intergenic
912462999 1:109849520-109849542 CAGGAATAGAAAGGGGCAGCTGG - Intergenic
912471497 1:109910280-109910302 CAGAGGAAGAAGGGGGCTGCCGG + Intronic
912764615 1:112396845-112396867 CAGAGGATGCGAGGGGCTGCGGG - Intronic
912889890 1:113518902-113518924 CAGGTAATGCAAGAGGCAGCTGG + Intronic
914827530 1:151146401-151146423 CCGGGCAGGGAAGGGGCTGCGGG - Intronic
916739755 1:167637792-167637814 GAAGGAATGAGCGGGGCTGCAGG - Intronic
917176556 1:172242223-172242245 CAGGGCAAGAAATGGGCTGAAGG + Intronic
917728139 1:177847205-177847227 CAGAGGAAGAAAGGGGCTGAGGG - Intergenic
917816733 1:178718256-178718278 CAGGGTATGAAAGAGTCTGTGGG + Intergenic
919980417 1:202639487-202639509 GAGGCACTGAAAGGGGCTGTGGG - Intronic
920218365 1:204377675-204377697 CAGAGAGCGAGAGGGGCTGCAGG - Intergenic
920558336 1:206920610-206920632 CAGAGTATGAAAGGGGATACAGG + Intronic
922244495 1:223782375-223782397 CAGAGAAGGAAAGTGGCTGTAGG + Intronic
922949900 1:229549998-229550020 CTGGGAATACAAGGTGCTGCAGG + Intronic
923051619 1:230394508-230394530 CAGGGAGTGAAAGGAGCTTGGGG - Intronic
923770029 1:236930462-236930484 TAGGGAGGGAAAGGGGCTGAGGG - Intergenic
924380760 1:243462122-243462144 GAGGGAATGAAGGGGGCTGCAGG + Intronic
1064093694 10:12407142-12407164 CAGGGCATGAGAGAGGCTGGAGG - Intronic
1064149314 10:12849523-12849545 CTGGGACTGACAGGGGCTGCTGG + Intergenic
1064288425 10:14012483-14012505 CAGGGTGTGAAAGGGGTGGCGGG + Intronic
1065722893 10:28643361-28643383 CAGGGCCTGGAAGGGGCTCCAGG - Intergenic
1065948326 10:30627090-30627112 CAGGGAAGGAATGTGACTGCAGG + Intronic
1067162533 10:43839462-43839484 CAGAGGAAGAAAGGGGCTGTAGG - Intergenic
1067346628 10:45442865-45442887 CAGAGAATGACAAGGGCAGCCGG - Intronic
1067467910 10:46514917-46514939 CAGGGACTGAGAGGCGCTCCTGG - Intergenic
1067665527 10:48274753-48274775 CAGGGAATGAGAGTGGTGGCAGG - Exonic
1068466459 10:57399294-57399316 CAGAGGATGAAAGGGGTTGGAGG + Intergenic
1069635533 10:69922705-69922727 CAGGGAGAGAAAGGCGATGCTGG + Exonic
1069654680 10:70079109-70079131 CAGGGAATGAGAGGAACTTCGGG + Intronic
1069686307 10:70321345-70321367 GTGAGAATGAAAGGGCCTGCTGG - Intronic
1070035511 10:72718994-72719016 GAGGGTATGAAGGGGGCTCCTGG + Intronic
1070370437 10:75777269-75777291 AAGGAAATGGAAGGGGCTGGGGG - Intronic
1070393432 10:75990772-75990794 TAGGAAATGCCAGGGGCTGCTGG + Intronic
1070504294 10:77099454-77099476 CAGGGACTGGAAGGAGCTACAGG + Intronic
1072282181 10:93876430-93876452 TAAGAAATGAAAGGGGCTGAGGG + Intergenic
1072883293 10:99249415-99249437 CAGCCAAAGAGAGGGGCTGCAGG - Intergenic
1073242166 10:102065937-102065959 CAGTGGCTGAAAGCGGCTGCTGG - Exonic
1074116308 10:110459770-110459792 CAGGGAATGCACAGGGTTGCCGG + Intergenic
1075371871 10:121944103-121944125 CAATGAATGAAAGGGGCTTGTGG + Intergenic
1075718455 10:124570652-124570674 CAGAGATTGAAAGAGGCTGGAGG - Intronic
1075832246 10:125421441-125421463 CATGGAATGCCAGGGACTGCTGG - Intergenic
1077068710 11:657268-657290 CAGGGAATGCAAGAGGAGGCTGG + Intronic
1077392427 11:2306309-2306331 CAGGAAATGAAAGAGCTTGCTGG + Intronic
1079871542 11:25804203-25804225 CAGGGGATCAAAGGGGATGTTGG - Intergenic
1080051312 11:27861713-27861735 CAAGGTATGAAAGTGGATGCTGG + Intergenic
1080244828 11:30168165-30168187 TAAGGAAGAAAAGGGGCTGCTGG - Intergenic
1081650796 11:44822868-44822890 AAGGGAATTAAAGGGACTGAGGG + Intronic
1081669848 11:44936884-44936906 CAGGGAAGGCAAGCGCCTGCGGG + Exonic
1083198732 11:61106516-61106538 CAGGGAATGAAGGGACCTGGGGG + Intronic
1084629136 11:70334383-70334405 CAGAGAATCAAAGGAGCTTCTGG + Intronic
1084915467 11:72425913-72425935 CAGGAAACTACAGGGGCTGCAGG - Intronic
1085259198 11:75194555-75194577 CAGAGAATGAAAGGGGGAGGAGG - Intronic
1087777405 11:102268845-102268867 CCGGGGATGACTGGGGCTGCCGG - Intergenic
1087961962 11:104363061-104363083 CAGGGAACAAAAAGGGCTGATGG - Intergenic
1089528081 11:119109780-119109802 TAGGGGATGAAAGGGATTGCAGG + Intronic
1089634535 11:119803863-119803885 CAGGGAAGGAAAGGTGTTTCTGG - Intergenic
1090046589 11:123340781-123340803 CAGAGAATGAATGGAGCTGGGGG - Intergenic
1091727900 12:2858324-2858346 CAGGGAAGGTAAGAGACTGCTGG + Exonic
1092174997 12:6398145-6398167 CAGAGAATAAAAGGAGCTACTGG - Intergenic
1093314893 12:17637138-17637160 CAGGGAATAGAATGGGTTGCAGG - Intergenic
1093669314 12:21853825-21853847 CAGGGAATGAAAGAAACTGAGGG + Intronic
1093861062 12:24168041-24168063 AAGGGAAGGCAAGGGGCTGAGGG + Intergenic
1094178329 12:27564815-27564837 CGGGGAGTCAAAGGGGCTGGCGG - Intronic
1098071376 12:66679306-66679328 CTGAGAAGGAAAGGGGCTGATGG - Intronic
1099139957 12:78960622-78960644 CATGTTATGAAGGGGGCTGCAGG + Intronic
1099227266 12:79984196-79984218 CAGTGCATGAAAGGGGAGGCTGG + Intergenic
1099769202 12:87030162-87030184 CGGATAATGAGAGGGGCTGCTGG + Intergenic
1100241035 12:92710812-92710834 CGGGCAATGACAGGGGCAGCTGG + Intergenic
1100446351 12:94663942-94663964 TTGGGAATGAAAGGAGCTGGAGG - Intergenic
1100567005 12:95806284-95806306 AAGGGAATGAAAGAGGCCGGAGG - Intronic
1102014277 12:109637525-109637547 CAGGGAAGGAGAGGAGGTGCTGG - Intergenic
1102043360 12:109814832-109814854 AAGGGAATGAAAGGGGAGTCAGG + Exonic
1102225246 12:111223930-111223952 CAGTGAATGCCAGGGGCTCCAGG - Intronic
1104329467 12:127830896-127830918 CAGTGAATGCAAAGGGCTGGAGG + Intergenic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1105260049 13:18772448-18772470 CAGCCCATGAAAGGAGCTGCAGG + Intergenic
1105321252 13:19324178-19324200 CCTGTGATGAAAGGGGCTGCTGG + Intergenic
1105408862 13:20153038-20153060 CAAGGAATGAAAGAGGCTAATGG - Intronic
1107617497 13:42185437-42185459 CTAGGAATGAAAAGGGCAGCAGG - Intronic
1108490453 13:50976262-50976284 CAGGGCCTGAGAGGAGCTGCTGG - Intergenic
1111089484 13:83424577-83424599 CAGGGAAGGAAATGAGGTGCAGG - Intergenic
1111578857 13:90196349-90196371 CAGGAAATGAAAGAGGCATCAGG - Intergenic
1112005458 13:95249794-95249816 CAGGGAATAAAACTGGCTCCAGG + Intronic
1112144192 13:96679706-96679728 CTGGGAAAGAAGGGGGCTACAGG - Intronic
1112294792 13:98177142-98177164 CCTGGACGGAAAGGGGCTGCAGG - Exonic
1112725038 13:102293483-102293505 CAGGAAATGAAAAGTGCAGCCGG - Intronic
1113675892 13:112207750-112207772 GAGGAAATGAGAGGGGGTGCGGG + Intergenic
1114497143 14:23140673-23140695 CAGGGCAGGCCAGGGGCTGCTGG - Intronic
1114655690 14:24314322-24314344 AAGGGGAGGAAAGGGGGTGCTGG + Exonic
1116101473 14:40442856-40442878 CATGGAATGACAGAGGGTGCTGG + Intergenic
1119415661 14:74467729-74467751 CATGGATTGAAAGGGGCTGATGG + Intergenic
1119599967 14:75968958-75968980 TAGGGAATGGTGGGGGCTGCGGG + Intronic
1121253678 14:92516661-92516683 CTGGGAGTGCAAGGGGCTGGGGG + Intronic
1121426353 14:93854868-93854890 CAGGGAAGGAATGGGGCAACAGG + Intergenic
1121640957 14:95484437-95484459 CACGGAGTAACAGGGGCTGCTGG + Intergenic
1121665520 14:95669107-95669129 CAGGGCTGGAAAGAGGCTGCTGG + Intergenic
1121707605 14:96010736-96010758 CAGCCAAAGAAAGGGGCTACAGG + Intergenic
1122781232 14:104144418-104144440 CAGGGAAGGAGGGGGACTGCAGG + Intronic
1124341735 15:28894347-28894369 GAGGGCATGGAGGGGGCTGCTGG + Intronic
1124439871 15:29678045-29678067 CAGGGAGTGAGGGGAGCTGCAGG - Intergenic
1124445028 15:29722752-29722774 CAGTCCATGAAAGGAGCTGCAGG + Intronic
1124496114 15:30188317-30188339 GAGGCACTGAAAGGGGCTGTGGG - Intergenic
1124747460 15:32350330-32350352 GAGGCACTGAAAGGGGCTGTGGG + Intergenic
1124965442 15:34429620-34429642 AAGGGCATGGAAGGGGTTGCTGG - Intronic
1124982061 15:34575822-34575844 GAGGGCATGGAAGGGGTTGCTGG - Intronic
1127453937 15:59141132-59141154 CAAGGAATGAAAGGGGATGGCGG + Intronic
1127534648 15:59878836-59878858 CAGGAAATCCAAAGGGCTGCTGG - Intergenic
1128555459 15:68628799-68628821 CAGGGAATGAATGGAGAGGCTGG - Intronic
1128640027 15:69329104-69329126 CAGGCACTGCAAGGGGCTGGTGG + Intronic
1129457795 15:75684945-75684967 CAGGGCATGAAGGGTGCTGCTGG - Intronic
1129993387 15:79984087-79984109 CAGGGAATGAAGGGAACTGGTGG - Intergenic
1130518818 15:84646443-84646465 CAAGGAAGAAAAGGAGCTGCCGG + Intronic
1131476868 15:92747276-92747298 CAGGGAATGCCAAGGGCTGCTGG - Intronic
1132092378 15:98956917-98956939 CAGGGATGGAGAGGGGCAGCAGG + Intronic
1132199936 15:99944343-99944365 CAGGGATGGAAAGGTGCTGAGGG + Intergenic
1132649519 16:1014220-1014242 CAGGGCAGGAGGGGGGCTGCAGG - Intergenic
1132699091 16:1214669-1214691 CAGGGTGTGAAATGGGCTGGGGG + Intronic
1132826338 16:1907467-1907489 CAGGGAAGGGAAGGGGAAGCCGG - Intergenic
1132849938 16:2020403-2020425 CAGGGAATGGAAGGGCCCGAGGG - Intronic
1132882471 16:2168529-2168551 TAGGGAATGAGCGGGGTTGCTGG + Intronic
1133025744 16:2988295-2988317 CAGAGAAGGAAAAGGGCTGCGGG - Intergenic
1133507308 16:6424475-6424497 AAGTGAAGGAAAGGGGCTCCAGG + Intronic
1135459033 16:22625201-22625223 AAGGAAATGAAAGGGGCTGGGGG - Intergenic
1135999941 16:27284760-27284782 CAGGGGAAGAAAGAGGCTGGGGG + Intronic
1136281201 16:29212422-29212444 CAGGCTATGAACGGGGCTGCAGG + Intergenic
1136590221 16:31214150-31214172 CAGGGACTCACAGGGGCAGCTGG - Exonic
1137060954 16:35791401-35791423 CAGGGAGTAAAAGGGACTTCAGG - Intergenic
1137251814 16:46746849-46746871 CAGGGAGGGGAAGGGGCAGCAGG + Intronic
1137724564 16:50648257-50648279 GAGGGAATGAAAGGGACTCTAGG - Intergenic
1137782226 16:51107403-51107425 TAGGTAAGGAGAGGGGCTGCAGG - Intergenic
1138107269 16:54294847-54294869 CAAAGAATGCAAGGGGTTGCTGG + Intergenic
1139795229 16:69477462-69477484 CAGTGACTGAGAGGGGCTTCTGG + Intergenic
1140043840 16:71426431-71426453 CCGCGAGTGCAAGGGGCTGCAGG + Intergenic
1140141660 16:72264096-72264118 CAGGCAATGGAAGGAGCTGAAGG + Intergenic
1141099270 16:81185202-81185224 CAGGGCAGGGAAGGGGCAGCTGG - Intergenic
1141410282 16:83828436-83828458 CGGAGGATGAAAAGGGCTGCAGG - Intergenic
1142085565 16:88178345-88178367 CAGGCTATGAACGGGGCTGCAGG + Intergenic
1142359547 16:89619706-89619728 AAGGGAGTGCAGGGGGCTGCAGG - Intronic
1143176860 17:4960393-4960415 CGGGGCATGAAAGGGCCAGCGGG - Intronic
1143389004 17:6549196-6549218 CAGGGCTGGCAAGGGGCTGCGGG - Intronic
1143659197 17:8314392-8314414 CAGGGGAGATAAGGGGCTGCAGG + Intronic
1144205262 17:12975351-12975373 CAGGGAATGAATGGAGGTGGCGG + Intronic
1144608252 17:16686812-16686834 CAGGGAAGGGAAGGTTCTGCTGG + Intergenic
1144816793 17:18040254-18040276 CAGGGTCTGAAAAGGGCTGGTGG - Intronic
1145006945 17:19343591-19343613 CTGGGAGGTAAAGGGGCTGCCGG + Intronic
1145196585 17:20899450-20899472 CAGGGAAGGGAAGGTTCTGCTGG - Intergenic
1145694131 17:26774237-26774259 CGGGGACAAAAAGGGGCTGCGGG - Intergenic
1145832409 17:27927344-27927366 CAGGGAATGAGAGAGGCACCTGG + Intergenic
1146559390 17:33855042-33855064 CAGGGGATGGAAGGGCATGCCGG + Intronic
1147260261 17:39206002-39206024 CAGGGCATGTAATGGGCTGATGG + Intergenic
1147330417 17:39696037-39696059 CAGGGAAGGGAAAGGGGTGCTGG - Intronic
1148186905 17:45650853-45650875 CTGGGAGTGAATGGGTCTGCTGG + Intergenic
1150132394 17:62676199-62676221 CAGAGAATAGAAGGGGCAGCTGG + Intronic
1150856514 17:68758447-68758469 AAGGGAATGAAAATGGCTGGAGG + Intergenic
1150897546 17:69231174-69231196 CAAGGAATGACAAGGGTTGCTGG - Intronic
1151106762 17:71624320-71624342 CAAGGAATGCAGGGGGCTTCTGG + Intergenic
1151348449 17:73517494-73517516 CAGGGAATGCCAAGGACTGCTGG + Intronic
1152029180 17:77831066-77831088 CCGGAAATGGAATGGGCTGCGGG - Intergenic
1152378239 17:79929565-79929587 CAGGGACAGACAGGGGCTGGCGG + Intergenic
1152401784 17:80070866-80070888 CAGGGAATGACCGTGGCTGTGGG + Intronic
1152650138 17:81488750-81488772 CAGGAAAGGAAATGGGCTGCGGG + Intergenic
1152723011 17:81932022-81932044 CAGGGTATGCAGGGGGCTCCAGG - Intergenic
1152778696 17:82217047-82217069 CAAGAAATGAAAGGGCCTGGTGG + Intergenic
1153505299 18:5790595-5790617 CAAGGAATGGAGAGGGCTGCTGG + Intergenic
1153784880 18:8525906-8525928 CAGGGAGAGAAGGGGGCTGTGGG - Intergenic
1153915152 18:9738411-9738433 CAGGGAAGGGAAGGGGCGGAAGG + Intronic
1154011679 18:10579930-10579952 CTGGGAGTGGAAGGGGCTGGTGG - Intergenic
1155305421 18:24473476-24473498 CAAGGAATGCCAGGGGTTGCTGG - Intronic
1158617994 18:59005482-59005504 CAGGAAATGAAAAGCCCTGCAGG - Intergenic
1158957315 18:62552204-62552226 CTGGGGAGGAAAGGGGCTTCTGG + Intronic
1158973328 18:62688364-62688386 CAGGGAATGCCAAGGGCTGCAGG - Intergenic
1160462538 18:79049974-79049996 CATGGAATGCATGGAGCTGCTGG + Intergenic
1161102536 19:2428365-2428387 CAGGGCTTGGAAGAGGCTGCAGG + Exonic
1161932433 19:7349820-7349842 CAGAGAATGAATGGGGGAGCTGG + Intronic
1164449174 19:28345176-28345198 CAGGAAGTGGAAGGAGCTGCTGG + Intergenic
1164618844 19:29681935-29681957 CAGGGAAGGAATGGGGATGTGGG + Intergenic
1165333812 19:35155458-35155480 CAGGGCAGGGAAAGGGCTGCAGG + Exonic
1165854545 19:38871570-38871592 AAGGGAATGAATGGGGCTTTGGG - Intronic
1166259546 19:41627920-41627942 GAGGGACTGGAAGGGCCTGCTGG + Intronic
1167189376 19:47973819-47973841 CAGTGAATGAAAGGAGAAGCAGG - Intronic
1167509742 19:49889751-49889773 CAGGTCATGCGAGGGGCTGCTGG + Exonic
1167615311 19:50529902-50529924 CTGGGAATGAAGGGGGCCCCAGG - Intronic
1168242954 19:55096339-55096361 CAAGGAGGGAAGGGGGCTGCAGG + Intronic
1168259749 19:55186693-55186715 CAGGGACTGAGAGGGGCGGAGGG + Intronic
1168397728 19:56063357-56063379 CCCGGTTTGAAAGGGGCTGCTGG - Intergenic
1168524670 19:57079215-57079237 CTGGGCATGCAAGTGGCTGCTGG + Intergenic
925015893 2:523858-523880 CAGGGAATGACAGTGGTTGTTGG + Intergenic
925869839 2:8260466-8260488 CAGGGAAGGGAAGGTGCTGCTGG - Intergenic
925876130 2:8312574-8312596 CAGGGAAAGAAAGAGGCTTAGGG - Intergenic
926511189 2:13781529-13781551 CAGGGAGAGAAAGGGGAGGCAGG - Intergenic
926891602 2:17643880-17643902 CAGGGAGTGAAAGCGGCCCCGGG + Intronic
927503055 2:23595176-23595198 CTGGGAAGGGAAGGGGCTGTGGG + Intronic
928088942 2:28362339-28362361 CAGGGAATAAAAGCAGCTGGTGG - Intergenic
928233762 2:29522480-29522502 CAGGGAGAGAATGAGGCTGCTGG - Intronic
928311832 2:30217703-30217725 CAGGGAATAAAAGGCCCAGCAGG + Intergenic
929978735 2:46659040-46659062 GAGGGCATGGAAAGGGCTGCAGG - Intergenic
930090654 2:47528965-47528987 CAGGCAAGGAAATGGGCTGAGGG + Intronic
930551113 2:52836018-52836040 CAGGGAATGCCAAGGGTTGCAGG - Intergenic
931636017 2:64341309-64341331 CAGGGAAAGAGAGGGGCAGCAGG + Intergenic
932309378 2:70727531-70727553 CAGGGAAGAAAAGGGTCTGAGGG - Intronic
932499847 2:72173893-72173915 CCGGGAATGAGAGAGGCTACAGG - Intergenic
933848627 2:86347997-86348019 CAAGGAATGCGAAGGGCTGCCGG - Intergenic
935495272 2:103772953-103772975 AAGGGATTGAAAGTTGCTGCCGG - Intergenic
935627504 2:105183530-105183552 CAGGGAATGATGTGGGCTGAAGG + Intergenic
935643122 2:105309289-105309311 CAGAGAATGACGGGAGCTGCAGG + Intronic
936284436 2:111171434-111171456 CAGGGAAAGAAAGGGGCAGTGGG - Intergenic
937453238 2:122019662-122019684 GAGGGAATCAAAGGGGCTGCAGG + Intergenic
943786976 2:191888124-191888146 CAGTGACTGAAAAGGGATGCAGG + Intergenic
946079666 2:217106610-217106632 CAGGCAGGGAAAGGGGGTGCAGG - Intergenic
946441444 2:219700394-219700416 CAGGGAGTGAAAGGAGCTGAAGG - Intergenic
948499574 2:238381892-238381914 CTGAGAAGGAAAGGGGCTGGCGG + Intronic
948525890 2:238570564-238570586 CAAGGGATGCAGGGGGCTGCGGG + Intergenic
948676512 2:239600248-239600270 CAGGGACTGTTAGTGGCTGCAGG + Intergenic
948999835 2:241606984-241607006 GAGAAAATGAAAGGGGATGCAGG + Intronic
1169566162 20:6855812-6855834 CAGGAAATAAAAGGGGCTTATGG - Intergenic
1169576380 20:6966535-6966557 CAAGGAATGACAAGGGTTGCAGG + Intergenic
1170459473 20:16563978-16564000 CAAGGGAGGGAAGGGGCTGCTGG - Intronic
1170841619 20:19928792-19928814 CAGGGAAGAAGAGGGGGTGCTGG - Intronic
1170852376 20:20017105-20017127 CTGGGAAGGAAAGAAGCTGCTGG - Exonic
1172251185 20:33480327-33480349 GAGGGAATGAAAAGCTCTGCGGG + Intergenic
1172965931 20:38835313-38835335 CAGGACATGATGGGGGCTGCAGG - Intronic
1173188588 20:40859659-40859681 CAGGCAGAGAACGGGGCTGCTGG + Intergenic
1174046859 20:47739975-47739997 CAGGTAATGAGAGTGGGTGCAGG - Intronic
1174388035 20:50198397-50198419 GAGGGAATGAAATAGGCTCCTGG + Intergenic
1174819302 20:53713370-53713392 CTGGGAGGGGAAGGGGCTGCAGG - Intergenic
1175033188 20:55975137-55975159 CTGGGAATGAGAAGGGCTGGTGG - Intergenic
1175053684 20:56178422-56178444 CAGGGAGTGAAGGAAGCTGCAGG + Intergenic
1175170767 20:57079892-57079914 CAGGGAAGGAAGGGGGAGGCAGG - Intergenic
1175373094 20:58505931-58505953 CAGGGAATGCCAAGGACTGCTGG + Intronic
1175547162 20:59785839-59785861 CAGGGGATGCAGAGGGCTGCTGG - Intronic
1175704118 20:61163141-61163163 CAGGGAAGGAAAGCGGGTGGAGG - Intergenic
1175862528 20:62157922-62157944 GAGGGAAGGAAAGGGTCTGGGGG - Intronic
1176264016 20:64199228-64199250 CTGGGAAGGAAGGGGGCTGGCGG - Intronic
1177367165 21:20153345-20153367 CAGGCTATGAAAGCAGCTGCAGG - Intergenic
1179054359 21:37917016-37917038 AAGGGACTGAATGGGGCAGCAGG - Intergenic
1179471293 21:41612487-41612509 CAGGGAATAAAGGGGGCAGGCGG + Intergenic
1179908765 21:44437261-44437283 CAGGGGCTGCAGGGGGCTGCAGG - Intronic
1180590460 22:16932810-16932832 CAGTGAATGAAAAAGGCTGCGGG + Intergenic
1181720975 22:24774232-24774254 CAGGAAAAGAAAGGGGGTGGAGG - Intronic
1181807480 22:25383765-25383787 AAGGGCATGAGAGGGGCTCCAGG + Intronic
1182452530 22:30429808-30429830 CTGGGACTTAAAGGGGCTGCAGG + Intergenic
1182668308 22:31974844-31974866 CAGGCAATGGAAGGGTCTGGAGG + Intergenic
1183037062 22:35148473-35148495 CTGGGATTGGAAGGGACTGCAGG + Intergenic
1183287885 22:36979147-36979169 CAGGGAAGGACAGGGGCCTCAGG + Intergenic
1183482858 22:38074649-38074671 CAGGGAACGCAGGAGGCTGCAGG - Intronic
1183716863 22:39538225-39538247 CTGGGGAGGAAAGGGGCTTCTGG - Intergenic
1183844897 22:40534668-40534690 CAGTTAATGAAAGGTGCTGTGGG - Intronic
1184205808 22:43001879-43001901 CAGGGACAGAGAGGGGCTCCAGG - Intronic
949097195 3:99630-99652 CTGGGAATAAAAGGGGCGGAGGG - Intergenic
950483111 3:13256899-13256921 CAGGGGAAGATAGGGGCCGCTGG - Intergenic
950861384 3:16150436-16150458 CAGGGAATGAAAGAGAATGCAGG + Intergenic
950964788 3:17138738-17138760 CAGGGAATGGCTTGGGCTGCTGG - Intergenic
952397913 3:32937556-32937578 CAGGAAATGACAGGGGCTAAAGG + Intergenic
953853743 3:46485145-46485167 CAGGTGATGATAAGGGCTGCTGG + Intronic
954662220 3:52232223-52232245 CAGGGAAGGTGAGGGGCAGCCGG - Intronic
954798033 3:53171483-53171505 CAGGGAGTGAGGGGGGCTGGAGG - Intronic
956212364 3:66814940-66814962 CAGGGAGAGAAAAGGGCTGAAGG - Intergenic
956787495 3:72654635-72654657 GAGTGAATGAATGTGGCTGCAGG - Intergenic
960663212 3:120083403-120083425 CAGGAAAAGAAAGGGGCAGGAGG + Intronic
960789989 3:121418405-121418427 GAAGGGATGAAAGGCGCTGCTGG + Exonic
961501055 3:127336374-127336396 GAGGGCATGAAAGCGGCTGTGGG - Intergenic
961613455 3:128159871-128159893 CAGGTAGTGAAAAGGGCTGCTGG - Intronic
963032615 3:140993749-140993771 GAGGGAATGGAAGGGGAGGCAGG - Intergenic
963659717 3:148109879-148109901 CAGGGAATCAAAAGTGCTGAAGG + Intergenic
966853459 3:184178286-184178308 GAGGGAATGAAAAAGGATGCAGG - Intronic
966948812 3:184797253-184797275 CAGGGTAGGACAAGGGCTGCAGG - Intergenic
968377240 4:53696-53718 CAGGGAAGGTGCGGGGCTGCGGG - Intronic
968401867 4:305074-305096 CAGGGAAGGTGCGGGGCTGCGGG + Intronic
969120275 4:4903521-4903543 CAGGGAAGCCAAGGGGTTGCTGG + Intergenic
969182642 4:5454028-5454050 GAGGGAATCTATGGGGCTGCTGG - Intronic
969248394 4:5951329-5951351 GAGGGAATGAAGGGGGGTGGTGG + Intronic
969257151 4:6010012-6010034 TAGGGAGTGAAAGGTACTGCAGG - Intergenic
969539483 4:7777989-7778011 CAGGGAAGGGAAGAGGGTGCTGG + Intronic
969832982 4:9813472-9813494 AAGGGAATGAATGTGGCTCCAGG - Intronic
971221620 4:24712778-24712800 AAGGGTATGAGTGGGGCTGCAGG + Intergenic
971856698 4:32053695-32053717 CAGCCAATGAAAGCAGCTGCAGG - Intergenic
973123049 4:46546557-46546579 CAGGGAATGAATGGAGCTGGAGG - Intergenic
973205974 4:47560531-47560553 AAAGGTATGAAAGGTGCTGCTGG + Intronic
975473450 4:74795082-74795104 CAGGGAATGGATGGGACTGCAGG - Intergenic
976438219 4:85043525-85043547 CAGGAAATGCAAGGGGTTGGGGG + Intergenic
981296507 4:143139330-143139352 CAGGCAATGAAATGGGCTCAGGG - Intergenic
982215102 4:153075972-153075994 CAGGGAAGGCAAGGGGGTGGGGG - Intergenic
982721820 4:158867842-158867864 CAGGCAATGGGAGGGGCTGTGGG + Intronic
983625552 4:169798360-169798382 CAGGTAAGAAGAGGGGCTGCAGG + Intergenic
984801253 4:183719040-183719062 CAGGTGATGAAAGGGACTGTTGG + Intergenic
985335054 4:188883405-188883427 CAAGGAATGACAAGGGTTGCCGG - Intergenic
985552807 5:541836-541858 CAGGCAAGGGACGGGGCTGCTGG + Intergenic
985956707 5:3271107-3271129 AAGGGAGGGAAGGGGGCTGCTGG - Intergenic
986203108 5:5597656-5597678 CAGGGAATGAAAGGCTGTGCAGG + Intergenic
986290262 5:6394066-6394088 CAAGGCATAAAAGGGGCTGCAGG + Intergenic
987051198 5:14147622-14147644 CCTGGAAAGACAGGGGCTGCAGG - Intronic
989543598 5:42646609-42646631 AAGGGAATGAATGGTTCTGCAGG + Intronic
992516680 5:77501083-77501105 CAGGAAGTGCAAGGGGTTGCAGG + Intronic
994045422 5:95303768-95303790 CAGGGGCTGATAGGGGCTGGAGG + Intergenic
995320666 5:110830326-110830348 CAGGGAATGATAGAGGCAGGAGG + Intergenic
995551108 5:113282330-113282352 CAGGGAATTAAAGGGTTTGAAGG + Intronic
999396582 5:151233127-151233149 CAAAGAATGAAGTGGGCTGCTGG - Intronic
999443807 5:151622816-151622838 CAGGACATCAAAGGTGCTGCAGG + Intergenic
999967065 5:156821103-156821125 CAGGGAATAAAAGAGGGTTCTGG - Intergenic
1000871360 5:166581299-166581321 GAGAGAAGAAAAGGGGCTGCAGG + Intergenic
1001154767 5:169263428-169263450 CAAGGAATGCCAAGGGCTGCTGG + Intronic
1001422160 5:171596343-171596365 CAGGGAAGGCAAGGGGTTTCTGG + Intergenic
1001605678 5:172958550-172958572 CAGGGAAGGAAAAGGGCTCTGGG - Intergenic
1002319325 5:178365685-178365707 CAGGAAACGCAAGGGTCTGCCGG - Intronic
1002456099 5:179345894-179345916 GAGGGAATGAAAGGGGAGGGGGG + Intergenic
1002790386 6:433387-433409 CAGGGAATACCAGGGGCTGAGGG + Intergenic
1003880104 6:10472353-10472375 CAGAGCATGAAAGAGGCTGCAGG + Intergenic
1004467943 6:15903229-15903251 CAGGGAATGCCAGGGATTGCTGG + Intergenic
1004919835 6:20366297-20366319 CAGTGAATGAAAATGGCTGCTGG + Intergenic
1005522763 6:26614535-26614557 CAGGGAATGAGAGGGGCCAAGGG - Intergenic
1006082328 6:31574731-31574753 CAGGGAGTGAAAGAGCCTCCAGG + Intergenic
1007102678 6:39260935-39260957 CAGGGAATGGAGGGGGCTTCAGG - Intergenic
1007370951 6:41426925-41426947 CTTGGAATCCAAGGGGCTGCTGG - Intergenic
1007385937 6:41520151-41520173 CAGGGGCTGAAAGGAGCTGCAGG + Intergenic
1009431551 6:63572257-63572279 CGGGGGAGGGAAGGGGCTGCCGG - Exonic
1010370549 6:75102024-75102046 CAAGGGATGAAAGGTGATGCTGG - Exonic
1010465476 6:76163018-76163040 CAGAGAATGTAGGGGGCTGCTGG + Intergenic
1011419465 6:87155989-87156011 CAGGGAAGGAAAGGGGAGGGGGG - Intronic
1011650388 6:89500668-89500690 CAGGAGATTAAAGGGGCTGTGGG + Intronic
1013597778 6:111675491-111675513 CAGGGAATTAAAAGGGATTCAGG + Intronic
1014550013 6:122779446-122779468 CAGGGATTCAATGGGGCTGGAGG - Intergenic
1016265890 6:142232346-142232368 CAGGAAGTGCAAGGGGCTGGGGG + Intergenic
1016882499 6:148924461-148924483 CAGGGAATGAAAGGGGAGTTGGG + Intronic
1019595321 7:1855720-1855742 CAGGCCATGAAAGGTGATGCTGG - Intronic
1020096782 7:5374062-5374084 CAGGGCCTGGAAGGGGCTGGGGG + Exonic
1021859786 7:24895018-24895040 CTGGGCATGGGAGGGGCTGCGGG - Intronic
1022507685 7:30916701-30916723 CAGGCACTGAAAGGAGCTGCTGG - Intronic
1022556726 7:31305667-31305689 CAGGGAAGAAAGGGGGCTTCAGG + Intergenic
1023055339 7:36285897-36285919 AGAGGAATGAGAGGGGCTGCTGG - Intronic
1023058584 7:36309242-36309264 CAGGGGAGGAAGGGGCCTGCAGG - Intergenic
1023719070 7:43074187-43074209 CAGGGACTGTCAGGGGGTGCGGG + Intergenic
1023940389 7:44765533-44765555 CAGGGACTGAGGGGGGCTGCAGG - Exonic
1024972429 7:55082904-55082926 CAAGGAATGCCAAGGGCTGCTGG - Intronic
1026544409 7:71309327-71309349 CAGGGAATGAGATGGGAGGCAGG - Intronic
1026793985 7:73354160-73354182 CATGGAATGAGAGCGCCTGCAGG - Intronic
1027222562 7:76223360-76223382 CAGGGAAGGGAAGGGTCAGCAGG + Intronic
1028011141 7:85646527-85646549 CAGGGAATGTGAGTGGCTTCAGG - Intergenic
1029896606 7:103990046-103990068 GAGGGAAGGAGAGGGGCGGCAGG + Intergenic
1030673487 7:112362455-112362477 CAGGGAATGAAAGCTGATGAAGG - Intergenic
1030699204 7:112620241-112620263 AAGGGACTGACAGGGCCTGCAGG - Intergenic
1032159122 7:129497232-129497254 CAGGGAATGATGGGGGCTAAGGG + Intergenic
1032357883 7:131227132-131227154 CAGGGAAAGAAACGGGTTACAGG - Intronic
1032933756 7:136704817-136704839 CTGGCAAGGAAAAGGGCTGCAGG + Intergenic
1034423076 7:150999278-150999300 CAGCCACTGAAGGGGGCTGCGGG - Exonic
1035004446 7:155644762-155644784 CAGAGAAGGGAGGGGGCTGCAGG - Exonic
1035389547 7:158496263-158496285 CAGGGAAGGGGAGGGGGTGCAGG - Intronic
1035389791 7:158496849-158496871 CAGGGAAGGGGAGGGGGTGCAGG - Intronic
1037695288 8:21218087-21218109 CAGGGGAACAAAGGGCCTGCAGG - Intergenic
1037770272 8:21794854-21794876 CAAAGAATGAACAGGGCTGCTGG + Intronic
1037787903 8:21913200-21913222 AAGGGAATGGAAGGGGCAGCTGG - Intronic
1038099010 8:24351055-24351077 AAGGCAATGAAAGAGGCTGACGG + Intronic
1038405694 8:27320823-27320845 TGGGGAAGGAAAGGGGCTGAAGG - Intronic
1038847722 8:31245245-31245267 CAGGATATCAAAGGGGCTACTGG - Intergenic
1039793171 8:40891530-40891552 CAGGGAACGCCAGGGGCTGGTGG - Intronic
1041100972 8:54396246-54396268 CTGGGAGTGAGAGGGGCTGGGGG + Intergenic
1041640989 8:60201445-60201467 CAGAGGATGAAAGGTGGTGCAGG + Intronic
1042716657 8:71780636-71780658 CAGGGGATGAAATGTGCTGATGG - Intergenic
1043437819 8:80251743-80251765 CAGGGAAGGAAAGAGCCTTCCGG + Intergenic
1043564608 8:81534247-81534269 CAGAGCAGGAAAGGGTCTGCAGG - Intergenic
1043970896 8:86527320-86527342 CAGGGAATGAAAGGGGCTGCAGG - Intronic
1045426641 8:102073642-102073664 CAGGGTATCACATGGGCTGCTGG + Intronic
1048346547 8:133580193-133580215 GAGGGAAGGAGAGGGGCTTCGGG - Intergenic
1048473128 8:134720975-134720997 CAGAGAACAAAAGGGGCTGAGGG + Intergenic
1049261628 8:141642076-141642098 CAGGGCAAGAAGGGGGCCGCAGG + Intergenic
1049391179 8:142372510-142372532 CAGGGACAGACAGAGGCTGCGGG + Intronic
1049467946 8:142761687-142761709 CAGGGGAGGGGAGGGGCTGCAGG + Intergenic
1049469316 8:142768404-142768426 CAAGCAATGACAGGGGATGCAGG + Intronic
1049554398 8:143274907-143274929 CAGGGAAGAAAAGGGGCCCCAGG - Intronic
1050397852 9:5218498-5218520 CAGGGAATGAAATGTGCAGTAGG + Intergenic
1052628253 9:31004635-31004657 CAGGAAATGCAAGGAGCTGGAGG + Intergenic
1052933207 9:34072589-34072611 CAGGGCATGTCAGGGCCTGCAGG - Intergenic
1053276660 9:36788331-36788353 AGGGGAATGAACGGGGCTACAGG + Intergenic
1055975326 9:81949593-81949615 CTGGGGAGGAAAGGGGCTCCTGG - Intergenic
1055980373 9:81994754-81994776 CTGGGAAGGAAAGGGGCTCTTGG - Exonic
1057000437 9:91504005-91504027 AAGGGAATGAAAGGGGAAGGAGG + Intergenic
1057310880 9:93942552-93942574 CAGGGAGTGAGTGGGGCTGTGGG - Intergenic
1058904029 9:109466845-109466867 CAGGGAATGACAGGGGGCACCGG + Intronic
1060264216 9:122101016-122101038 TAGGGAACGTAAGGGGGTGCTGG + Intergenic
1060519997 9:124288887-124288909 GGGGCAATGAAGGGGGCTGCAGG - Intronic
1060884558 9:127141199-127141221 CAGGGAATGCCAGGGGTTGTGGG + Intronic
1060890212 9:127183355-127183377 GGGGGCATGGAAGGGGCTGCAGG - Intronic
1060927803 9:127467446-127467468 GAGGGAGGGAAGGGGGCTGCAGG + Intronic
1061150802 9:128826978-128827000 CAGGGAGAGGGAGGGGCTGCCGG - Intronic
1061626330 9:131842704-131842726 CTGGGAATGGATGGGGCTGGAGG + Intergenic
1061692008 9:132340891-132340913 CAGAGAATAAAATGGGCTGTGGG - Intronic
1062096157 9:134705026-134705048 CAGGGGAAGATTGGGGCTGCTGG - Intronic
1062600846 9:137318043-137318065 CAGAGAATGTAAGGGTCTCCAGG + Intronic
1203571996 Un_KI270744v1:140550-140572 CAGGGAAGGTGCGGGGCTGCGGG + Intergenic
1186473987 X:9842932-9842954 CAGGGTCTGAAAAGGGCTCCTGG - Intronic
1187000185 X:15168569-15168591 CAGGAAATGAAAGTGGTTGGGGG - Intergenic
1189214259 X:39309838-39309860 CAGGAAATGAAGGGGCCTGTCGG + Intergenic
1190108435 X:47574495-47574517 CAAGGCCTGAAAGGTGCTGCTGG + Exonic
1190870279 X:54419164-54419186 CAGGAAATAAAGGGAGCTGCAGG - Intergenic
1191051165 X:56194273-56194295 CAGGAAGTGAAAGGGGTTGGGGG + Intergenic
1191778483 X:64843782-64843804 CAGGGAATGAAAAAGTCTGCAGG - Intergenic
1193174806 X:78380163-78380185 CAGGGGAAGAAGGGGGCTGAAGG - Intergenic
1193447257 X:81619551-81619573 GGGGGAATGAAAGGGGTGGCTGG - Intergenic
1194091792 X:89586796-89586818 AACGGAATGTAAGGGGCTTCAGG - Intergenic
1197331984 X:125164272-125164294 GAGGGATTGAAAGTGGCTGGAGG - Intergenic
1200045038 X:153396751-153396773 CAGGGAAGGAATGGGGGTGGTGG + Intergenic
1200444430 Y:3242861-3242883 AACGGAATGTAAGGGGCTTCAGG - Intergenic
1201583144 Y:15532192-15532214 CAGGAAATGCAAGGGGTTGGGGG - Intergenic