ID: 1043973266

View in Genome Browser
Species Human (GRCh38)
Location 8:86556780-86556802
Sequence GTGGTTATAAAAGGGCAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 7, 3: 34, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043973266_1043973273 16 Left 1043973266 8:86556780-86556802 CCTGGTTGCCCTTTTATAACCAC 0: 1
1: 0
2: 7
3: 34
4: 138
Right 1043973273 8:86556819-86556841 TTCTAGCCCTTCCTTAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043973266 Original CRISPR GTGGTTATAAAAGGGCAACC AGG (reversed) Intronic
900979903 1:6040457-6040479 GTGGTTAAAAAAGATCAACCAGG - Intronic
901281282 1:8037157-8037179 GTGGGTAGAGATGGGCAACCTGG + Intergenic
905741121 1:40372778-40372800 GTGGTTTTAAAAGGTCACTCTGG - Intronic
905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG + Intronic
907600743 1:55766841-55766863 GTGGTGGTAACAGGGCTACCAGG + Intergenic
907826458 1:58021792-58021814 GTGGGTCTGAAAGGGCAACCGGG + Intronic
909066749 1:70944374-70944396 ATGGTGGTAACAGGGCAACCAGG - Intronic
909193864 1:72591301-72591323 GTGGTTAAAAAAAGTCAACTTGG + Intergenic
916799689 1:168204785-168204807 GTGGGTAAAAAAGGGCAAAATGG + Intergenic
919149945 1:193683294-193683316 GTGGGGATAAAAGAGCATCCTGG - Intergenic
920875950 1:209836000-209836022 ATGGTTATAAAAGGGCAACAAGG - Intronic
922688067 1:227663513-227663535 GTGTTTACAAAAGGGGAGCCGGG - Intronic
1063032389 10:2248406-2248428 CTGGTTATAAAATGGTAAACTGG - Intergenic
1067266578 10:44750735-44750757 GTGGTTATAAAAGGGCCACAAGG + Intergenic
1069795147 10:71047078-71047100 CTAGTTTTAAAAGGTCAACCTGG + Intergenic
1069899929 10:71701459-71701481 GGGGTTATAAGTGGGGAACCAGG + Intronic
1070071778 10:73096878-73096900 GAGGTTATAAAAGGGCTAACGGG - Exonic
1075796421 10:125123206-125123228 ATGACTATAAAAGGGCAACGGGG + Intronic
1076621720 10:131793180-131793202 GTGGTGATAACAGGACAAGCTGG + Intergenic
1076723138 10:132401453-132401475 ATGGCTCTAAAAGGGCAGCCTGG + Intronic
1078314672 11:10284381-10284403 GTGGTTATAAAAGGGTAATTGGG - Intronic
1078793043 11:14564160-14564182 ATGATTATAAAAGGGCAGCATGG - Intronic
1081184410 11:40024550-40024572 GAGGATATAAAATGGCATCCTGG - Intergenic
1081570455 11:44287401-44287423 GGGGCTATAAAATGGAAACCTGG - Intronic
1083806312 11:65076413-65076435 GTTGTTAAAAAATGACAACCAGG - Intronic
1084449435 11:69227080-69227102 GTGGCAATAGAAGGGCACCCTGG + Intergenic
1086176216 11:83894142-83894164 GTGGTTACAAGAAGGCAACAAGG - Intronic
1086378876 11:86230426-86230448 TTAGTCATCAAAGGGCAACCTGG + Intergenic
1088335300 11:108697136-108697158 TTGGTTACAAAAGGTCAAACAGG - Intronic
1093406999 12:18816617-18816639 GTGGTTATAAAATGGCATCCTGG + Intergenic
1094013785 12:25839556-25839578 ATGGTAATAACAGAGCAACCTGG - Intergenic
1095795825 12:46217809-46217831 GTGGTTTTAAAAGGCCAGGCAGG + Intronic
1098011166 12:66053991-66054013 GTGGTTTTGACAGGGCTACCAGG + Intergenic
1100503265 12:95194622-95194644 GTGGGTATAAAAGGACAAGAGGG + Intronic
1100503379 12:95195788-95195810 GTGGGTATAAAAGGACAAGAGGG + Intronic
1100915487 12:99415981-99416003 GTAGCTATAAAAGGGCAATGGGG - Intronic
1106232958 13:27836088-27836110 GTGGCTATAAAAGGGCATCAGGG - Intergenic
1106480698 13:30135108-30135130 GTGGTCAAAACAGGGCAACATGG + Intergenic
1107669824 13:42733579-42733601 GAGGTTATAAAAGGGCTAATTGG + Intergenic
1108441905 13:50462739-50462761 GTGGCTATAAAAGGGCACCACGG + Intronic
1113563462 13:111302655-111302677 GTGGTTATAAATGGACAAAAAGG + Intronic
1114037207 14:18640835-18640857 GTGGTTCTAAAATGGCAGCCAGG + Intergenic
1114121434 14:19674208-19674230 GTGGTTCTAAAATGGCAGCCAGG - Intergenic
1117445700 14:55801837-55801859 TTGGTTTTACAAAGGCAACCTGG - Intergenic
1117909563 14:60624088-60624110 GTGATAGTAAAAGGGAAACCAGG + Intergenic
1120633357 14:86919828-86919850 CTGGCTATAAAAGGGAAACAAGG - Intronic
1121170264 14:91847957-91847979 GTGGTTGTAGAATGGCTACCAGG + Intronic
1121295086 14:92814010-92814032 GTGTTAATAAAAGGGGAAACAGG + Intronic
1125448785 15:39786231-39786253 ATGGTGAGGAAAGGGCAACCGGG - Intergenic
1127496608 15:59518617-59518639 GAAATAATAAAAGGGCAACCAGG - Intronic
1127629910 15:60818530-60818552 CTGGTTATAAATGGGCAAGGTGG - Intronic
1127795912 15:62438206-62438228 GTGGTTATTTAAGGGAAAACAGG + Intronic
1130808812 15:87355116-87355138 GTGGATCTACAAGGGCAATCTGG + Intergenic
1134194005 16:12144511-12144533 GCTGTTATAAAAGGGCTAGCTGG + Intronic
1135050286 16:19186985-19187007 GCGGTAATAAATGGGCAATCAGG + Intronic
1140848732 16:78914577-78914599 GTGAGTATAAGAGGGAAACCAGG + Intronic
1140861993 16:79026100-79026122 GTGTTTTGAAAAGGGCAACAGGG - Intronic
1151398358 17:73839880-73839902 GTGGTTAAGTCAGGGCAACCTGG - Intergenic
1153613076 18:6907679-6907701 GTGGCTATAAAGAGGCAACAGGG + Intronic
1155917972 18:31574516-31574538 GTGTTCATAAATGGGGAACCTGG - Intergenic
1156269684 18:35519303-35519325 GGGGTTATTAAAGAGGAACCAGG + Intergenic
1159031060 18:63232834-63232856 CTGTTTATAAAATGACAACCTGG + Intronic
1161390550 19:4018312-4018334 GTGGTTATAAAATAGCAGCCAGG - Intronic
1162769148 19:12938574-12938596 GTGGGTATAAAAGTGCAAGGCGG + Intronic
1163463422 19:17452879-17452901 TTTGTTGGAAAAGGGCAACCTGG + Intronic
1164087190 19:21913657-21913679 GTTAATAGAAAAGGGCAACCTGG + Intergenic
1164519169 19:28964646-28964668 GTGGCTATGAAAGGGCAGCAGGG + Intergenic
925626170 2:5843772-5843794 ATGGTCACAAAAGGGCCACCAGG + Intergenic
926169452 2:10542906-10542928 GTGGATTTAAAAGAGAAACCTGG + Intergenic
926358406 2:12062560-12062582 TGGGTTATAACAGGGGAACCTGG - Intergenic
936104326 2:109612328-109612350 GTGGTTATAAAAAGGCATTAAGG + Intronic
938223457 2:129593749-129593771 GTGCTTATAAGAGTGCAACCCGG + Intergenic
938273781 2:129998228-129998250 GTGGTTCTAAAATGGCACCCAGG - Intergenic
938278134 2:130045760-130045782 GTGGTTCTAAAATGGCACCCAGG - Intergenic
938329104 2:130436561-130436583 GTGGTTCTAAAATGGCACCCAGG - Intergenic
938360841 2:130684932-130684954 GTGGTTCTAAAATGGCACCCAGG + Intergenic
938437245 2:131291625-131291647 GTGGTTCTAAAATGGCACCCAGG + Intronic
938442427 2:131347887-131347909 GTGGTTCTAAAATGGCACCCAGG + Intronic
938983692 2:136551802-136551824 GCAGTTTTAAAAGGGCAACATGG - Intergenic
940111508 2:150160081-150160103 TTGGTGATAAAAGGGAATCCAGG + Intergenic
943068418 2:183113391-183113413 GGGGTTATAAAAGGGCAACATGG + Intergenic
943565176 2:189508613-189508635 GTGGTTACAAAAAGGCAACAAGG + Intergenic
943779513 2:191806535-191806557 GTGATTATAAAAGGGGAAGTGGG - Intergenic
945617429 2:212089956-212089978 GTGCTTATAAAATGTCTACCAGG + Intronic
945724272 2:213455930-213455952 AGGGTTTTAAAAGGGCAACCTGG - Intronic
947750804 2:232530934-232530956 CTGGTTCTACAAGGACAACCTGG + Intronic
1169423921 20:5481652-5481674 GTGGTTATAAAAGGTACAGCTGG + Intergenic
1170958576 20:21004044-21004066 CAGGTTATCACAGGGCAACCTGG + Intergenic
1172582691 20:36060920-36060942 GTGGTAATAATAGGGGAAGCAGG + Intergenic
1174411157 20:50337292-50337314 TTGGTTATACAAGGGCAATGAGG + Intergenic
1176311994 21:5155841-5155863 CTTTTTATAAAAGGGCAAACTGG - Intergenic
1180461330 22:15567883-15567905 GTGGTTCTAAAATGGCAGCCAGG + Intergenic
1180746655 22:18093877-18093899 GTGGTTAGGAAAGGGCAGGCGGG + Exonic
1180911997 22:19457268-19457290 ATGGTTATAAAAAGACAACATGG - Intronic
1181736697 22:24887221-24887243 CTGGCTATAAAAGGACAACGTGG - Intronic
1182094469 22:27616564-27616586 GGGGATGTCAAAGGGCAACCAGG + Intergenic
950578710 3:13849105-13849127 GTGGCTATACAAGGGCAACCTGG + Intronic
952594627 3:35001125-35001147 GTGGTTATAAAAAGACAATGAGG + Intergenic
961335028 3:126170675-126170697 ATGGTTATAAAAGGACAAGAGGG - Intronic
961400749 3:126640505-126640527 GTGATTATGACAGGGCATCCAGG - Intronic
965254474 3:166387434-166387456 TTGGATATAAATGAGCAACCAGG + Intergenic
965606891 3:170506760-170506782 CTGGTTCTAAAAGGGCAATAGGG - Intronic
967164729 3:186770471-186770493 GTGGCTATTAAAGGGCAACATGG - Intergenic
968328330 3:197841464-197841486 GTGATTATATTAGGTCAACCTGG + Intronic
970062325 4:12049317-12049339 ATGCTGATAAAATGGCAACCTGG + Intergenic
970423531 4:15926479-15926501 GTGATTAAAAATGGGAAACCAGG - Intergenic
970797876 4:19936057-19936079 GTGATTATAAATGGAGAACCTGG + Intergenic
972425480 4:38928779-38928801 GTGGACATAAAAGGGCACCTGGG + Intronic
972839235 4:42911561-42911583 CTGGTGATAGAAGGGCAACTAGG + Intronic
976813666 4:89122731-89122753 GGGTTTATAAAAGGGAAACCTGG - Intergenic
979523999 4:121698136-121698158 GGGGTTATTAAAGGTCAACATGG + Intergenic
979897165 4:126173180-126173202 GTGGTTATAAAAGTCCAATTAGG - Intergenic
984472525 4:180194533-180194555 GTGGTTCTTAAGGGTCAACCAGG + Intergenic
987943918 5:24579505-24579527 GTGGATTTAAAAGGGCATACAGG - Intronic
992488912 5:77222071-77222093 GTGGCTGCAAAAGGGTAACCTGG + Intronic
994035019 5:95188699-95188721 GTGGTTATTAAAGGGCAATGCGG + Intronic
994642518 5:102427777-102427799 ATGTTTATAAAAGGGGAAACTGG + Intronic
995527608 5:113063053-113063075 CTGGTGATAAGAGGGAAACCTGG - Intronic
995955350 5:117770061-117770083 GTGGTTATAAAAGGAGGAACAGG - Intergenic
996851331 5:127956627-127956649 ATGTTTATAAAAGGGCAACATGG + Intergenic
996942908 5:129030925-129030947 ATGGTTGTAAAAGGACAACATGG - Intronic
997676744 5:135718858-135718880 GTGGTTATCAAAGGGCAAGGGGG + Intergenic
999063663 5:148661507-148661529 ATGTTTAAAAAAGGGCAACCAGG + Intronic
1000323305 5:160152218-160152240 GTGGTTATGAAAGAGCAACATGG - Intergenic
1000888275 5:166773466-166773488 GTGGCAATAACAGGGCATCCAGG + Intergenic
1001164793 5:169354291-169354313 GTGGTTATAAAAAGGCAACAGGG + Intergenic
1003077905 6:2999198-2999220 GTGGCTATAAAAACGCAACCCGG - Intronic
1003085148 6:3054566-3054588 GTGGCTATAAAAACGCAACCCGG + Intergenic
1005244733 6:23869933-23869955 GTGGCTATAAAAGGGAAACAGGG + Intergenic
1006093637 6:31642744-31642766 GTGGTTATATAATGGCAAGAAGG + Intronic
1007503563 6:42316834-42316856 GGGATTATAAAAAGGCAAGCTGG - Intronic
1010138780 6:72587872-72587894 GTAGTTATAAAAGGGCAAAATGG - Intergenic
1011786810 6:90855766-90855788 GTGGTTCTCAAAGTGCAGCCTGG - Intergenic
1012045653 6:94269573-94269595 GTGATTTTAAAAGAGCCACCAGG + Intergenic
1013430839 6:110053626-110053648 GTGGTAATAGAAGGGTCACCGGG - Intergenic
1014683267 6:124461186-124461208 TTGGTCAAAAAAGGTCAACCTGG + Intronic
1017649999 6:156571941-156571963 GTGCTTATAAAGAGGAAACCAGG + Intergenic
1019349389 7:546784-546806 GTGGCTATAAAAAGGCAGCTGGG - Intergenic
1019761072 7:2813374-2813396 CTGGTTATTAAGGGGCATCCAGG + Intronic
1020995445 7:15258069-15258091 GTTGTTATAAGATGGCAATCCGG - Intronic
1021542652 7:21777049-21777071 GTGGTTATAAAATGGCAACATGG - Intronic
1021900320 7:25278964-25278986 GCGGTTGCAAAATGGCAACCTGG + Intergenic
1025873058 7:65452983-65453005 CTGTTTATAAAGGGGAAACCTGG - Intergenic
1025907455 7:65798840-65798862 GTGGTTAAAAAAAGGCAGACTGG + Intergenic
1026399689 7:69997049-69997071 GTGATTATAAATGTGCAGCCAGG + Intronic
1026627219 7:72005823-72005845 GTTGTCATTAAAGGGCAACAGGG + Intronic
1026644308 7:72154590-72154612 GTGGTTATATCAGGGCAAAAAGG - Intronic
1027478160 7:78659661-78659683 GTGGCTATAAAAGGACAACATGG + Intronic
1030269896 7:107660249-107660271 GTGGGTAAGAAAGGGCCACCTGG + Intergenic
1034081290 7:148280003-148280025 GTGGTTAGAAAAGGAAAACAAGG + Intronic
1034567196 7:151924610-151924632 GTGGAGATCAAAGGTCAACCAGG + Intergenic
1039624856 8:39038455-39038477 GTGATTTTAAAAGGGCAGTCAGG - Intronic
1039721264 8:40167280-40167302 GTGCTTTTAAAAGGTCAAGCTGG + Intergenic
1040943662 8:52858313-52858335 GTGGCTATAAAAGGGGAACTTGG - Intergenic
1041186834 8:55309442-55309464 GTCATTATAAAAGGGCAATATGG + Intronic
1041768142 8:61442048-61442070 GTGCCTATAAAAGGGTAACATGG - Intronic
1042042568 8:64608596-64608618 GTGGTTATAAAAGGGGGAGAGGG + Intronic
1042042582 8:64608638-64608660 GTGGTTATAAAAGGGGGAGAGGG + Intronic
1042756782 8:72223065-72223087 CTGGTTCTAAGAGGGCAGCCTGG - Intergenic
1043220729 8:77660180-77660202 GTGGTGACAAAAGGGTAACAGGG + Intergenic
1043973266 8:86556780-86556802 GTGGTTATAAAAGGGCAACCAGG - Intronic
1045252241 8:100491763-100491785 GTGTTTTTAAAAGGGCTCCCAGG - Intergenic
1045428865 8:102094766-102094788 GTCCTTATAAAAGGGAAATCTGG + Intronic
1047692100 8:127366375-127366397 GTAGGTTTAAAAGGGCAATCAGG - Intergenic
1048908702 8:139113529-139113551 GTGGTTCAGAAAGGGCAACCAGG + Intergenic
1051068452 9:13133537-13133559 ATAATTATAAAAGGGCAAGCTGG + Intronic
1052589694 9:30475453-30475475 GCGCTTAGAAAAGCGCAACCTGG + Intergenic
1052726799 9:32238317-32238339 ATGGCTATAAAAGGACAACATGG + Intergenic
1055266593 9:74500252-74500274 GGGGTCAGGAAAGGGCAACCAGG - Intronic
1056914660 9:90735619-90735641 GTGGCTATAAAAGGTTAACATGG + Intergenic
1057048515 9:91904206-91904228 GTGGTTAAAAAAGGATGACCTGG - Intronic
1187315706 X:18192836-18192858 GTGGTTATTAAAGAGCAAGATGG + Intronic
1188710398 X:33390047-33390069 CTGGTTCTCAAAGTGCAACCTGG + Intergenic
1191175144 X:57491425-57491447 TTGGTGATACAAAGGCAACCAGG + Intergenic
1193643133 X:84036154-84036176 GTGGCTATAAAAGACCAACATGG - Intergenic
1193754708 X:85394281-85394303 GTGATTATAAAGGAGCAACATGG - Intergenic
1195010377 X:100727876-100727898 GTGGGAATACAAGGGCAATCGGG + Intronic
1198160110 X:133999763-133999785 CTGTTTATAAAGGGGAAACCTGG + Intergenic
1198496192 X:137196036-137196058 GTGGTTATAAAAGGGTGAGGGGG + Intergenic
1200333870 X:155326946-155326968 GTGGCTTTAAAAGGGCAACACGG + Intronic