ID: 1043978624

View in Genome Browser
Species Human (GRCh38)
Location 8:86612446-86612468
Sequence TGGACAGGACCACCCACAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043978624_1043978632 27 Left 1043978624 8:86612446-86612468 CCTCTTGTGGGTGGTCCTGTCCA 0: 1
1: 0
2: 0
3: 8
4: 160
Right 1043978632 8:86612496-86612518 TGAACTAATTGTAGAGTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043978624 Original CRISPR TGGACAGGACCACCCACAAG AGG (reversed) Intronic
901831179 1:11893589-11893611 CTGACAGGACCACCAACATGAGG + Intergenic
907116198 1:51970542-51970564 TGAGCAGGGCCACCCACAATAGG - Intronic
907763788 1:57388427-57388449 GGGACAGAACCACCTACACGAGG - Intronic
914751408 1:150537561-150537583 TGAACAGGACCACCCAGAGGAGG + Intergenic
915234766 1:154472573-154472595 TGCACAGGCCCACCCACAGAAGG - Intronic
923442979 1:234039209-234039231 TGCACAGCAAAACCCACAAGGGG + Intronic
1062761854 10:28458-28480 TGGACAAGACCTCCCAACAGGGG + Intergenic
1071947241 10:90658989-90659011 TGGAGTGAACCACCCACAGGTGG - Intergenic
1072978448 10:100079468-100079490 AGTACAGGAGCACCAACAAGGGG + Intronic
1073798476 10:107014386-107014408 TGGACAGTGGCCCCCACAAGAGG - Intronic
1076561123 10:131364925-131364947 TGGAGAGGACCTCCCACCACTGG - Intergenic
1076903679 10:133351941-133351963 TGGACAGAACCCCCCGCAGGAGG - Intronic
1081632363 11:44698409-44698431 TGCGCAGGACCACCATCAAGGGG + Intergenic
1083158161 11:60838258-60838280 AGCACAGGAGCACCCAGAAGAGG + Intergenic
1084564574 11:69921744-69921766 GACACAGGCCCACCCACAAGTGG - Intergenic
1087656606 11:100930776-100930798 TGGTTAGGACGACCCACATGTGG + Intronic
1088196766 11:107282394-107282416 GGGACAGTACCACCCTCTAGGGG + Intergenic
1090125161 11:124076518-124076540 TGCTCCGGACCACCCGCAAGCGG + Intergenic
1101987742 12:109460845-109460867 TGCTCAGGGCCTCCCACAAGAGG - Intronic
1102080147 12:110091257-110091279 TGGACAGAACAAACCACATGAGG - Intergenic
1103274676 12:119701458-119701480 TGGAGAGGAGCATCCCCAAGGGG + Intronic
1103394513 12:120597488-120597510 CGGCCAGCACCACCCACAGGTGG - Intergenic
1105068054 12:133217108-133217130 AGGACTGGACCTCCCAAAAGGGG - Intergenic
1107891875 13:44921186-44921208 TGGACAGGGCCTCACAGAAGGGG + Intergenic
1107982640 13:45748399-45748421 TGGTAAGGACCACCCAGAACTGG + Intergenic
1110694783 13:78475245-78475267 TTGGCAGGAGCACCTACAAGTGG + Intergenic
1114058866 14:19001139-19001161 TGGACAGGACCTCCCAACTGGGG + Intergenic
1114103678 14:19400615-19400637 TGGACAGGACCTCCCAACTGGGG - Intergenic
1118249636 14:64147111-64147133 TGGAAAGAACCACCTACTAGGGG - Intronic
1118503473 14:66386062-66386084 TGGCCACCACCACTCACAAGTGG + Intergenic
1119189228 14:72669020-72669042 TAGACAGAACAACCCAAAAGTGG + Intronic
1120187865 14:81413245-81413267 TGGACTGTGCCACCCACCAGTGG + Intronic
1122814410 14:104305393-104305415 TAGACAGGGCCGCCCACATGGGG + Intergenic
1202836134 14_GL000009v2_random:78679-78701 TGTACAGGACCTCCCAAATGGGG + Intergenic
1123496856 15:20834858-20834880 TGGACAGGATCTCCCACCTGAGG - Intergenic
1123554088 15:21408450-21408472 TGGACAGGATCTCCCACCTGAGG - Intergenic
1123590335 15:21845815-21845837 TGGACAGGATCTCCCACCTGAGG - Intergenic
1126738708 15:51756613-51756635 TGGACAGGAGCAGTCACTAGTGG + Intronic
1128767465 15:70259919-70259941 TGAGCAGCACCAACCACAAGAGG + Intergenic
1129470601 15:75751468-75751490 TGGACAGCCACACCCACAATGGG + Intergenic
1129721148 15:77878824-77878846 GGGACAGGAGGACCCAGAAGTGG + Intergenic
1202962436 15_KI270727v1_random:135646-135668 TGGACAGGATCTCCCACCTGAGG - Intergenic
1132844529 16:1993698-1993720 TGGCCAGAACCACCCACACCTGG - Exonic
1132953247 16:2576864-2576886 TGGAAGGGACCACTCAGAAGCGG + Intronic
1132961105 16:2623304-2623326 TGGAAGGGACCACTCAGAAGCGG - Intergenic
1137859270 16:51830165-51830187 TGGTCAGGACCACCTACAGTTGG - Intergenic
1138729485 16:59178947-59178969 TGGATAGGAGCACCCACGTGGGG + Intergenic
1142118454 16:88373568-88373590 TGGACCAGACCACCCTCAAGAGG + Intergenic
1142908303 17:3063508-3063530 TGGACAGGAACATCCAAAACAGG + Exonic
1142911220 17:3092897-3092919 TGGACAGGAACATCCAAAACAGG + Exonic
1142926263 17:3240753-3240775 TGGACAGGAACATCCAAAACAGG - Intergenic
1147383605 17:40069758-40069780 TGGGCATGACCACCCACCAGTGG + Intronic
1151354094 17:73548389-73548411 TGGACAGGAGGACCCACTCGGGG - Intronic
1151396271 17:73825144-73825166 TGGACAGGAGCAGCCACGAGGGG + Intergenic
1151554713 17:74840885-74840907 TGGACAGGGCCACCCACTCTTGG + Intergenic
1152330576 17:79670309-79670331 TGGGCAGGACCTGCAACAAGGGG - Intergenic
1152534592 17:80943170-80943192 TGGACAGTGCCAGGCACAAGCGG + Intronic
1152535805 17:80949772-80949794 GGGACAGGGGCACCCACGAGTGG - Intronic
1152775090 17:82196171-82196193 TGGGCAGGACCACCCACAGCTGG + Intronic
1153389830 18:4544029-4544051 TGGACTGCAATACCCACAAGTGG + Intergenic
1154454870 18:14511231-14511253 TGGACAGGATCTCCCACCTGAGG - Intronic
1155503162 18:26506796-26506818 TGGTCACCACCAGCCACAAGTGG + Intronic
1160585872 18:79913066-79913088 TGGACAGGGGCAGCCCCAAGGGG + Intronic
1161664409 19:5566036-5566058 TGGCCAAGACGACCCTCAAGTGG - Intergenic
1161802990 19:6426095-6426117 GAGCCAGGACGACCCACAAGGGG + Exonic
1162222635 19:9191306-9191328 TGGACAGGAACAGCCCAAAGAGG - Intergenic
1162223977 19:9204382-9204404 TGGACAGGAACAGCCCAAAGAGG - Intergenic
1162225139 19:9214738-9214760 TGGACAGGAACAGCCCAAAGAGG + Exonic
1162227400 19:9235221-9235243 TGGACAGGAACAGCCCAAAGAGG - Intergenic
1163069612 19:14828142-14828164 TGGACAGGAACAGCCCAAAGAGG + Exonic
1163071057 19:14841778-14841800 TGGACAGGAACAGCCCAAAGAGG + Exonic
1163073332 19:14864616-14864638 TGGACAGGAACAGCCCAAAGAGG + Intergenic
1165755943 19:38293044-38293066 AGGAAAGGAACACCCACAGGAGG - Intronic
1166911754 19:46163985-46164007 TGGGCAGGACCTCCCAAATGGGG - Intergenic
1168300536 19:55402340-55402362 TGGGTTGGACCACACACAAGAGG + Intronic
1168705823 19:58469812-58469834 TGTCCAGGACCACCTACAGGAGG + Exonic
1202636503 1_KI270706v1_random:48683-48705 TGTACAGGACCTCCCAAATGGGG - Intergenic
927972746 2:27316033-27316055 TGGGCAGGAACACCCAGCAGGGG - Intronic
928242599 2:29599865-29599887 AGGACAAGACCACCCTCATGAGG + Intronic
929361591 2:41098396-41098418 TGGAAAATATCACCCACAAGAGG + Intergenic
929867785 2:45733235-45733257 AGGACAGGGCCAGCCACCAGGGG - Intronic
936095427 2:109527485-109527507 TGGACTGGAAGACCCCCAAGAGG + Intergenic
937241446 2:120465026-120465048 TGGACAGGACCTCCCAGCAGCGG + Intergenic
938282329 2:130073092-130073114 TGGACAGGACCTCCCAACTGGGG - Intergenic
938332959 2:130461664-130461686 TGGACAGGACCTCCCAACTGGGG - Exonic
938356850 2:130659007-130659029 TGGACAGGACCTCCCAACTGGGG + Intergenic
938433286 2:131265813-131265835 TGGACAGGACCTCCCAACTGGGG + Intronic
938477329 2:131628399-131628421 TGGACAGGACCTCCCAACTGGGG + Intergenic
944375608 2:199038362-199038384 TGAACAGCCCCACCAACAAGGGG - Intergenic
946749149 2:222875768-222875790 TGAACTGGACAACCCAAAAGGGG - Intronic
1170581784 20:17704864-17704886 CTGACAGGATCCCCCACAAGTGG + Intronic
1170915215 20:20616676-20616698 TGGACAGCACCACTCAACAGGGG + Intronic
1174846508 20:53948442-53948464 TGGACAGGTCCTGCCACAATGGG + Intronic
1174872088 20:54192433-54192455 TGGCCAGAACCCCCCACCAGAGG + Intergenic
1175391269 20:58628860-58628882 TGGACAGGAGCAGCCATGAGTGG - Intergenic
1175663210 20:60835665-60835687 TGGACAAGACACCTCACAAGTGG + Intergenic
1176419174 21:6500131-6500153 TGGCCAAGGCCACCCACAGGTGG + Intergenic
1176680846 21:9818490-9818512 TGGACAGGACCAGACACCCGTGG - Intergenic
1176819295 21:13642077-13642099 TGGACAGGATCTCCCACCTGAGG + Intergenic
1179694667 21:43108453-43108475 TGGCCAAGGCCACCCACAGGTGG + Intergenic
1180051165 21:45331655-45331677 GGGCCAGGACCACCCAGAATGGG + Intergenic
1180364367 22:11925631-11925653 TGTACAGGACCTCCCAAATGGGG + Intergenic
1180477351 22:15723755-15723777 TGGACAGGACCTCCCAACTGGGG + Intergenic
1181516854 22:23419249-23419271 TGAACAGTACCACCTCCAAGGGG - Intergenic
1181864985 22:25847694-25847716 GGGACATGTCCACCCACCAGTGG + Intronic
950050661 3:9986604-9986626 TGGGTAGGACCACCCAGAGGCGG + Exonic
950191805 3:10981837-10981859 AGGATGGGACCACCCACACGGGG + Intergenic
955094691 3:55785629-55785651 TGGACAGCACAAGCCTCAAGAGG - Intronic
955804743 3:62722389-62722411 TGGTGAAGACCACCCTCAAGTGG + Intronic
957131803 3:76232776-76232798 TAGAAAAGACCACTCACAAGAGG - Intronic
958108891 3:89114148-89114170 TGGACAGGAGTAGCCACAGGAGG + Intronic
960909439 3:122634238-122634260 TGGTCAGGAGAACACACAAGGGG - Intronic
961013649 3:123450829-123450851 TACACAGCACCAGCCACAAGAGG + Intergenic
961556029 3:127697174-127697196 TGGCCAGGCCCAACCACAGGGGG + Intronic
966340841 3:178923807-178923829 TGGGCAGGACCTCCCAAATGGGG + Intergenic
966765060 3:183453742-183453764 TGGGCAGGACCACTTACACGTGG - Intergenic
968001408 3:195209351-195209373 TGGACAGGAGCACGCAGCAGCGG - Intronic
968498009 4:929129-929151 GAGTCAGGACCACACACAAGTGG + Intronic
969103029 4:4784367-4784389 TGGACAGGATCTCCCTGAAGAGG - Intergenic
969848678 4:9939718-9939740 TGGACAGAAACACCCACTAATGG - Intronic
971969231 4:33600283-33600305 AGGACACGAACACACACAAGGGG - Intergenic
973394296 4:49580383-49580405 TGTACAGGACCTCCCAAATGGGG + Intergenic
978295746 4:107203317-107203339 TGGACAGGACCAAGAACGAGGGG + Intronic
983729170 4:170972013-170972035 TGGAAAAGATCACCCACAAGAGG - Intergenic
983898964 4:173113054-173113076 TGGGCAGGACCTCCCAAATGGGG + Intergenic
1202763819 4_GL000008v2_random:134553-134575 TGTACAGGACCTCCCAAATGGGG - Intergenic
991157708 5:63458641-63458663 TGGGCAGGACCTCCCAAATGGGG + Intergenic
991263766 5:64692880-64692902 TGGACAGGGCCATGCACGAGTGG + Intronic
997237078 5:132278822-132278844 TGGACAGGGGCACCCAGAGGTGG - Intronic
1000745605 5:165029643-165029665 TGGACAGGACCGCTCCCTAGTGG - Intergenic
1000990413 5:167906306-167906328 TGTTTAGCACCACCCACAAGAGG - Intronic
1002075259 5:176704738-176704760 TGGCCAGGAACACCCACTTGGGG - Intergenic
1003492948 6:6639810-6639832 TGTGCAGGACCCCCCAAAAGTGG - Intronic
1004384368 6:15159673-15159695 TGGATTGGAACACCTACAAGTGG + Intergenic
1006594044 6:35179620-35179642 TTGACAGCAGCACCCCCAAGGGG + Intergenic
1016335522 6:143001011-143001033 TGGACAGGACCTCCCTCAGCGGG + Intergenic
1021175952 7:17449786-17449808 TGGACAGGACCTCCCAACTGGGG - Intergenic
1023999733 7:45182550-45182572 TGGACAGGGGGACCCACAGGAGG + Intronic
1024491789 7:49994252-49994274 TATGCAGGACCACCCAAAAGTGG - Intronic
1028111076 7:86942057-86942079 TGGACACCACCACTGACAAGTGG - Exonic
1033230560 7:139594131-139594153 TGGACAGGTCCACACAGTAGAGG - Intronic
1036701063 8:11014337-11014359 GGCACAGGACCAACCACAAAAGG + Intronic
1037799298 8:22023893-22023915 TGGCCAGGACAACCCAGGAGAGG - Intergenic
1043978624 8:86612446-86612468 TGGACAGGACCACCCACAAGAGG - Intronic
1047928322 8:129702290-129702312 TGGACCACACCACCCAGAAGAGG + Intergenic
1048474135 8:134727978-134728000 GAGACAGGAGCACCCAAAAGTGG - Intergenic
1049007377 8:139863988-139864010 GGGACAGCACCGCCCACCAGTGG + Intronic
1049980532 9:900224-900246 GGGCCAGGAACACTCACAAGGGG - Intronic
1051609745 9:18949585-18949607 GGGGCAGGAGCACCCACAATGGG - Intronic
1052311770 9:27075722-27075744 TGGGCAGGACCTCCCAGCAGGGG - Intergenic
1056436242 9:86578177-86578199 TGTACTGGACCACCCAAGAGCGG + Intergenic
1056773445 9:89496059-89496081 TGGAGAGGACTGTCCACAAGTGG + Intronic
1057281232 9:93713057-93713079 TTGCCAGGAACACCCGCAAGGGG - Intergenic
1057307339 9:93920050-93920072 TGTACAGGACCACCCCCACCCGG + Intergenic
1057424284 9:94935918-94935940 GGCACAGGTCCACCCACAACAGG + Intronic
1057972662 9:99572484-99572506 TGCACAGGAACACCCACAGGAGG - Intergenic
1058460226 9:105175641-105175663 TTGTCAGGACATCCCACAAGGGG + Intergenic
1060803049 9:126556841-126556863 TGGTCAGGACCACTCCTAAGGGG - Intergenic
1062253635 9:135610801-135610823 TGGACAGGAGCACCCATACCGGG + Intergenic
1203528063 Un_GL000213v1:107493-107515 TGGACAGGATCTCCCACCTGAGG - Intergenic
1203544571 Un_KI270743v1:119426-119448 TGTACAGGACCTCCCAAATGGGG - Intergenic
1188830532 X:34891300-34891322 TTGACTGGAACACCTACAAGGGG + Intergenic
1192921602 X:75713058-75713080 AGGGAAGGACCACCCACAGGTGG + Intergenic
1193715143 X:84928092-84928114 TGGGCAGGACCTCCCAAATGGGG - Intergenic
1194947944 X:100091309-100091331 TGGGCAGGACCTCCCAACAGGGG + Intergenic
1195148637 X:102043569-102043591 TGGGCAGGACCACCCAACCGGGG + Intergenic
1196794141 X:119488924-119488946 AGGACAGCACCGTCCACAAGGGG + Intergenic
1201756750 Y:17494456-17494478 TGGGCAAGACCTCCCAAAAGGGG + Intergenic
1201844803 Y:18411528-18411550 TGGGCAAGACCTCCCAAAAGGGG - Intergenic