ID: 1043982754

View in Genome Browser
Species Human (GRCh38)
Location 8:86659857-86659879
Sequence TCAGGTTAGCAGATGATGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 2, 2: 28, 3: 8, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043982749_1043982754 13 Left 1043982749 8:86659821-86659843 CCAGAATTTCTTGGTTTTGTTGT 0: 1
1: 0
2: 6
3: 95
4: 923
Right 1043982754 8:86659857-86659879 TCAGGTTAGCAGATGATGCAGGG 0: 1
1: 2
2: 28
3: 8
4: 117
1043982747_1043982754 22 Left 1043982747 8:86659812-86659834 CCAGTTGATCCAGAATTTCTTGG 0: 1
1: 0
2: 2
3: 16
4: 199
Right 1043982754 8:86659857-86659879 TCAGGTTAGCAGATGATGCAGGG 0: 1
1: 2
2: 28
3: 8
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043982754 Original CRISPR TCAGGTTAGCAGATGATGCA GGG Intronic
901353486 1:8620771-8620793 TCAGGCAAGCAGAAGAGGCAGGG - Intronic
903071572 1:20729425-20729447 CCAGGTTTGCAGATGAGGAAGGG - Intronic
904407871 1:30305265-30305287 TGTGGTCACCAGATGATGCAGGG - Intergenic
904787824 1:32995845-32995867 GCAGGTTGGCAGAGGGTGCAAGG + Intergenic
905231220 1:36515945-36515967 TCAGGTCACCAGATGGTGCTGGG + Intergenic
908124610 1:61017791-61017813 TAAGGTTAGCAAAAGATCCAGGG + Intronic
913659649 1:120994858-120994880 TGTGGTCACCAGATGATGCAAGG + Intergenic
914011010 1:143777982-143778004 TGTGGTCACCAGATGATGCAAGG + Intergenic
914166820 1:145183125-145183147 TGTGGTCACCAGATGATGCAAGG - Intergenic
914649630 1:149686637-149686659 TGTGGTCACCAGATGATGCAAGG + Intergenic
916710250 1:167399091-167399113 TCAGGTTAGAAAATGAAGCTGGG - Intronic
924147766 1:241094754-241094776 TCTGGATTGCAGATGTTGCAGGG + Intronic
1065918473 10:30371076-30371098 TCAGGGTAGCAGATGATGCAGGG + Intronic
1068077230 10:52271443-52271465 TCAGAGAAGCAGATCATGCAGGG + Exonic
1070122357 10:73590697-73590719 TCAGGTTAACAGATGCTTCTGGG - Intronic
1073101475 10:101008894-101008916 TCAGGTTGGGGGCTGATGCAGGG - Intronic
1073893359 10:108125033-108125055 TGTGGCTATCAGATGATGCAGGG + Intergenic
1074250013 10:111735638-111735660 TCAGGTGAGCAGAGGGGGCATGG + Intergenic
1089373877 11:117980571-117980593 TAAGGTTTGCAGATTATTCAGGG + Intergenic
1091578029 12:1757572-1757594 TCAGGGTAGCGGATGGTGCCGGG + Intronic
1101210792 12:102533616-102533638 TCAGGTTCTGAGATCATGCACGG - Intergenic
1101316979 12:103638209-103638231 ACAGGTGAGCAAATGATGCAGGG + Exonic
1101943986 12:109121902-109121924 TCAGGTCAGCACGTGATGAATGG + Intronic
1103317240 12:120065853-120065875 TCAGCTTAGCTGATGGTGCCAGG - Intronic
1106586583 13:31062243-31062265 ACAGGTGAGGAGAGGATGCAGGG + Intergenic
1109888529 13:68575664-68575686 GCAGGATATCAGATCATGCAGGG + Intergenic
1112985493 13:105444351-105444373 TCTGGTTAGCATTTGATTCAAGG + Intergenic
1114534494 14:23414172-23414194 TCAGGATATCAGATGAAGCAGGG - Intronic
1115069087 14:29299611-29299633 TTAGGTTAGCAAATGGGGCATGG + Intergenic
1117092359 14:52263968-52263990 AAAGGTTAGAAGATTATGCAAGG + Intergenic
1118073108 14:62267850-62267872 TCAGGTTAGCACATGAGCTAGGG + Intergenic
1118818821 14:69331523-69331545 GAAGGTCAGCAGATGCTGCAAGG - Exonic
1121917630 14:97850709-97850731 TCAGCTTAGCAGAATGTGCAAGG + Intergenic
1123472368 15:20564951-20564973 TCAGGGTAGCAGATGATGTAGGG - Intergenic
1123634143 15:22286401-22286423 TCAGGCGAGCAGAAGAGGCAGGG + Intergenic
1123645635 15:22435402-22435424 TCAGGGTAGCAGATGATGTAGGG + Intergenic
1123666888 15:22614967-22614989 TCAGGGTAGCAGATGATGTAGGG + Intergenic
1123732673 15:23159942-23159964 TCAGGGTAGCAGATGATGTAGGG - Intergenic
1123750806 15:23357322-23357344 TCAGGGTAGCAGATGATGTAGGG - Exonic
1124283177 15:28381238-28381260 TCAGGGTAGCAGATGATGTAGGG - Exonic
1124299522 15:28530375-28530397 TCAGGGTAGCAGATGATGTAGGG + Exonic
1124320728 15:28709540-28709562 TCAGGGTAGCAGATGATGTAGGG + Exonic
1124481765 15:30085809-30085831 TCAGGGTAGCAGATGATGTAGGG - Exonic
1124488221 15:30137907-30137929 TCAGGGTAGCAGATGATGTAGGG - Exonic
1124521826 15:30411392-30411414 TCAGGGTAGCAGATGATGTAGGG + Exonic
1124536838 15:30554827-30554849 TCAGGGTAGCAGATGATGTAGGG - Exonic
1124543312 15:30606881-30606903 TCAGGGTAGCAGATGATGTAGGG - Exonic
1124563269 15:30794333-30794355 TCAGGGTAGCAGATGATGTAGGG - Intergenic
1124755305 15:32400413-32400435 TCAGGGTAGCAGATGATGTAGGG + Exonic
1124761814 15:32452764-32452786 TCAGGGTAGCAGATGATGTAGGG + Exonic
1124776815 15:32596304-32596326 TCAGGGTAGCAGATGATGTAGGG - Exonic
1124960017 15:34386900-34386922 TCAGGGTAGCAGATGATGTAGGG + Intronic
1124976646 15:34533121-34533143 TCAGGGTAGCAGATGATGTAGGG + Intronic
1125182424 15:36892441-36892463 TCAGGTTTGCAGAGCATGCCAGG - Exonic
1126879995 15:53084153-53084175 TCAGGGTGGCAGAGGCTGCAAGG + Intergenic
1127106127 15:55618262-55618284 TTAGACTAGCAGATGATGCTGGG + Exonic
1129029337 15:72607297-72607319 TTAGGGTAGCAGATGATGCAGGG - Intergenic
1129586006 15:76865871-76865893 TCAGGTAAGTAGATGACACATGG - Intronic
1129895684 15:79104210-79104232 TAACGTCAGCAGAGGATGCAGGG - Intergenic
1130259945 15:82346838-82346860 GCAGGGTAGTAGAGGATGCACGG + Exonic
1130268780 15:82432598-82432620 GCAGGGTAGTAGAGGATGCACGG - Exonic
1130281283 15:82522171-82522193 CCAGGGTAGTAGAGGATGCACGG - Intergenic
1130472658 15:84238354-84238376 CCAGGGTAGTAGAGGATGCACGG - Exonic
1130480149 15:84352925-84352947 CCAGGGTAGTAGAGGATGCACGG - Intergenic
1130484380 15:84390496-84390518 CCAGGGTAGCAGATGATGCACGG - Intergenic
1130491620 15:84435204-84435226 CCAGGGTAGTAGAGGATGCACGG + Intergenic
1130503235 15:84514244-84514266 CCAGGGTAGTAGAGGATGCACGG + Intergenic
1130594953 15:85242988-85243010 CCAGGGTAGTAGAGGATGCACGG - Intergenic
1131624738 15:94105559-94105581 TCAGGATTGCAGATGATGTTAGG - Intergenic
1132000858 15:98179030-98179052 TCAGGTCAGCCTTTGATGCAGGG - Intergenic
1132433607 15:101779375-101779397 TCAGGGTAGCAGATGATGTAGGG + Intergenic
1135664665 16:24325743-24325765 TCAGGTTTGCAGAGCAGGCATGG + Intronic
1135847994 16:25936305-25936327 TCAGATATGCAGATGATACAAGG + Intronic
1137341044 16:47605626-47605648 TCAGTTTAGCTCATGATACAGGG - Intronic
1138278407 16:55753747-55753769 TCACTTTAGAAGATCATGCAAGG + Intergenic
1141446433 16:84061611-84061633 TCAAGTGAACAGATGCTGCATGG - Intronic
1142134262 16:88444433-88444455 TCAGGAGAGCAGATGCTTCAAGG - Intergenic
1150034840 17:61783373-61783395 ACAGGTTAGCAGGTGATGAGGGG + Intronic
1153406086 18:4741172-4741194 TCATGTTACCAGATGAGACAGGG - Intergenic
1157482756 18:48066096-48066118 GAAGGTTAGGAGATGATGCCTGG - Intronic
1159317372 18:66794502-66794524 TCAGGTTAGCTGATGTTAGATGG + Intergenic
1162349133 19:10138246-10138268 CTAGGGAAGCAGATGATGCAGGG + Intronic
1165016293 19:32882653-32882675 TTAGGTTACCAGTTGATGCAGGG - Intronic
1165156775 19:33793525-33793547 TCAGGTTTCCAGATGTTTCAAGG - Intergenic
925720837 2:6825197-6825219 TCAGTGTAGCAGCTGATGCTTGG + Intergenic
926166101 2:10522807-10522829 TCAAGTGAGCAGATGGTGCCAGG - Intergenic
926567959 2:14498559-14498581 ACAGCTTGGCAGATGTTGCAGGG + Intergenic
926942132 2:18149666-18149688 TCAGGTTATCACATGGTGAAGGG + Intronic
928374307 2:30762630-30762652 TCAGGTAAGCAGGTGATGCCAGG - Intronic
930764218 2:55068300-55068322 TGATGTTACTAGATGATGCATGG - Intronic
932222635 2:70011480-70011502 CCAGGTGAGCAGATGAGGGAAGG + Intergenic
933058959 2:77711151-77711173 TCAGATAAGAAGATCATGCATGG - Intergenic
935503732 2:103873200-103873222 TTAGGTTAGCAGACGAAGGAAGG - Intergenic
935699861 2:105802099-105802121 TCAGATTTGCAGACGATGCATGG + Intronic
938212041 2:129476132-129476154 TCATGTAAACAGATGATGAAGGG + Intergenic
946865270 2:224036777-224036799 ACAGGTGAGCTGAGGATGCAGGG + Intronic
1170433502 20:16298774-16298796 TCTGGTTTTCAGAAGATGCAGGG + Intronic
1172975573 20:38903421-38903443 TCAGGGGAGCTGATGAGGCAAGG - Intronic
1177902468 21:26933783-26933805 TCAGGTTATCTGATGATGAATGG + Intronic
1178602241 21:34004672-34004694 TTAGGTTAGAAAATGATCCAGGG + Intergenic
950203400 3:11060626-11060648 TCAGTTTCACAGATGAGGCATGG + Intergenic
950422043 3:12904989-12905011 TCAGGTCAGCAAGAGATGCAGGG + Intronic
958982890 3:100744928-100744950 TCAGGTGAGCAGGTGTTGAAAGG + Exonic
960115811 3:113890814-113890836 TCAGGTTTACAGATGAGCCAAGG + Intronic
961103196 3:124219605-124219627 TCAGGTTAGCAGAGGCTCCTGGG + Intronic
961835808 3:129658338-129658360 TCAGGTGAGAAGATGAGGAAAGG - Intronic
962071498 3:132037866-132037888 TAAGGGGAGCAGATGATGAAGGG + Intronic
968654062 4:1771122-1771144 TCTGGGTAGCAGAGGAGGCAGGG + Intergenic
970318613 4:14853802-14853824 TCAAGCCAGCAGATGAGGCAAGG - Intergenic
970753346 4:19393641-19393663 TCATGTTAGCACATGAAACAGGG + Intergenic
975808817 4:78142510-78142532 TCAGGGTTGCAGATAATGAACGG + Intronic
982083213 4:151810028-151810050 CCAGATTAGCAGACAATGCAAGG - Intergenic
994934063 5:106229524-106229546 TCAGGTTAACATATGATATAAGG - Intergenic
995902313 5:117084339-117084361 TCCAGTTAACAGATGATGGAAGG - Intergenic
997580275 5:135012596-135012618 TCAGGTTAGCAGAAAATGCATGG + Intergenic
1000153253 5:158524463-158524485 TTTGGTTGGCAGATGATGCAAGG + Intergenic
1006874569 6:37284140-37284162 ACATGTGAGCAGATGAAGCAAGG - Intronic
1010177662 6:73048455-73048477 TCAGGGTAGCAGAGGCTACATGG - Intronic
1021459774 7:20873038-20873060 TCAAGTTCCCAGATGATGCAGGG + Intergenic
1022451879 7:30523418-30523440 TCAGGGTAGCAGATGATGTAGGG + Intronic
1024537337 7:50449081-50449103 TCAGGATAACAGATGATAAAGGG - Exonic
1029464541 7:100716930-100716952 CAAGGTGAGCAGAGGATGCAGGG + Intergenic
1030582781 7:111380827-111380849 TAAGGTTAGCAGTTTATGCCTGG - Intronic
1031472399 7:122182547-122182569 TTAAGTTAGCAGGTGATGAATGG - Intergenic
1034441548 7:151088139-151088161 TCAGGCAAGCAGATGAAGCTGGG - Intronic
1036476242 8:9095985-9096007 TCAGGTCAGCCTATGACGCAAGG - Intronic
1041571210 8:59338556-59338578 TGAGGCTAGAAGATGAAGCACGG + Intergenic
1042904291 8:73757401-73757423 TCAGGCCTGCAGATGATGCTGGG - Intronic
1043234601 8:77847036-77847058 TCAGATGAGAAGATGATACAAGG - Intergenic
1043317626 8:78941049-78941071 TCAGGAATGGAGATGATGCATGG - Intergenic
1043982754 8:86659857-86659879 TCAGGTTAGCAGATGATGCAGGG + Intronic
1044433796 8:92138569-92138591 TCTGGTTTGCAGATGACACATGG - Intergenic
1044436555 8:92171063-92171085 TCATGTTATCAGATGACGGATGG - Intergenic
1046181625 8:110656242-110656264 TCAGGTAGGCTGATGATGAATGG - Intergenic
1048700376 8:137082017-137082039 TCTGGTTACCAGGGGATGCAAGG - Intergenic
1052563833 9:30120802-30120824 TCAGGTTACCAGACACTGCAAGG + Intergenic
1053265655 9:36711281-36711303 TCTGGTTGGCAGATGAGGGAAGG + Intergenic
1056681105 9:88720024-88720046 TCATATTAGCAGGTGATGCTGGG - Intergenic
1056898705 9:90578136-90578158 GCAGGTTTGCAGATTATACACGG - Intergenic
1060704525 9:125785868-125785890 CCAGGTTGGGAGATGATACAAGG + Intronic
1061064244 9:128267469-128267491 TCAGGTTAGCAGACGATGCAGGG + Exonic
1061855696 9:133440847-133440869 TCAGATGAGCAGATGTTGCTGGG + Intronic
1185633397 X:1534496-1534518 TCGGGTTAGGAGATTCTGCACGG - Intronic
1188488523 X:30710332-30710354 CTAGGTTAGCAGATGAAGGAAGG - Intronic
1190536810 X:51437067-51437089 TGAGGTTACAAGATCATGCATGG - Intergenic
1192263304 X:69522276-69522298 TCAGGTGAGCAGAGGAGTCAGGG - Intronic
1194268842 X:91784581-91784603 TAAGGTTCAGAGATGATGCAGGG - Intronic
1198776215 X:140182146-140182168 TCAGGACAGTACATGATGCATGG - Intergenic
1199056909 X:143307431-143307453 TCAGGTGTGCAGATGATCAAAGG + Intergenic
1200586055 Y:5005593-5005615 TAAGGTTCAGAGATGATGCAGGG - Intronic
1202305524 Y:23466077-23466099 TCAGGTGAGCAGAAGAGGCTGGG + Intergenic
1202366689 Y:24170682-24170704 CCAGGGTAGCAGATGATGCAGGG - Intergenic
1202373715 Y:24214800-24214822 CCAGGGTAGCAGATGATGCATGG + Intergenic
1202497066 Y:25455320-25455342 CCAGGGTAGCAGATGATGCATGG - Intergenic
1202504093 Y:25499441-25499463 CCAGGGTAGCAGATGATGCAGGG + Intergenic
1202565285 Y:26204512-26204534 TCAGGTGAGCAGAAGAGGCTGGG - Intergenic