ID: 1043986579

View in Genome Browser
Species Human (GRCh38)
Location 8:86699748-86699770
Sequence CTTGGACAACCCTATAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 1, 2: 1, 3: 13, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043986579_1043986582 19 Left 1043986579 8:86699748-86699770 CCAAATTTATAGGGTTGTCCAAG 0: 1
1: 1
2: 1
3: 13
4: 121
Right 1043986582 8:86699790-86699812 TCATAATTTCCAATATCTGCAGG No data
1043986579_1043986583 22 Left 1043986579 8:86699748-86699770 CCAAATTTATAGGGTTGTCCAAG 0: 1
1: 1
2: 1
3: 13
4: 121
Right 1043986583 8:86699793-86699815 TAATTTCCAATATCTGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043986579 Original CRISPR CTTGGACAACCCTATAAATT TGG (reversed) Intronic
902763805 1:18601586-18601608 CTTGGACAACCCCAGAGAGTTGG - Intergenic
903457528 1:23498038-23498060 CTGGCAAAACCCTATAAAGTAGG - Intergenic
904830401 1:33302788-33302810 ATTGGCCAACACTATAAATCAGG + Intergenic
906648687 1:47494763-47494785 ATTGGCAAACACTATAAATTGGG + Intergenic
907855250 1:58296889-58296911 TCTGGACAACCCTATGAAGTAGG - Intronic
909120111 1:71592635-71592657 CTTGGACAACTATATGATTTGGG + Intronic
911095706 1:94053349-94053371 CTTGGACAACCCATTAATATAGG + Intronic
914373909 1:147055206-147055228 CTTGGCCAAACCTATTAATACGG + Intergenic
920451991 1:206066245-206066267 AGTAGACACCCCTATAAATTAGG - Intronic
1063444514 10:6101974-6101996 TGTGGTCAACTCTATAAATTGGG + Intronic
1065620318 10:27574454-27574476 CTTAGACAAGTCTTTAAATTAGG + Intergenic
1070433426 10:76364014-76364036 CATCAACAACCCTATAAATATGG - Intronic
1071280755 10:84100524-84100546 CTTGGAAAACCGAATAGATTAGG - Intergenic
1071295574 10:84216983-84217005 CTTGGACAACCCCAGGAACTTGG + Exonic
1087862379 11:103175891-103175913 TTTTAACAACCCTATAAAGTAGG - Intronic
1089402714 11:118173543-118173565 CTTCGACAGCCCTATGAAGTTGG - Intronic
1090864112 11:130681157-130681179 CTTGAACAACACTATAAACCAGG + Intronic
1091036606 11:132239608-132239630 CTTGGCCAACGGTATAAATTGGG + Intronic
1092312521 12:7373946-7373968 CTTGGACACCCCTGCAAATGAGG - Intronic
1098122129 12:67252669-67252691 CTTATACAACCCTATGAAATAGG + Intergenic
1098823226 12:75259836-75259858 ATTGGACAACGTTATAAGTTGGG + Intergenic
1099505698 12:83473375-83473397 CGTGGACCACCCTATTAATATGG + Intergenic
1100068255 12:90678166-90678188 CTTGGACCAGCCTTTCAATTTGG - Intergenic
1103160875 12:118728242-118728264 CTAGGACAACCATATGAAGTAGG + Intergenic
1104320916 12:127749914-127749936 CTTGGCCATCTCTATAACTTTGG + Intergenic
1105872021 13:24513430-24513452 CTTAGACAACCCTATAGAGTAGG - Intergenic
1105917598 13:24931425-24931447 CTTAGACAACACTATAGAGTAGG + Intergenic
1106652290 13:31704297-31704319 CTTATAAAACCCTATAAATTAGG + Intergenic
1106695176 13:32165133-32165155 TTTGGAAAATTCTATAAATTTGG - Intronic
1109822575 13:67677610-67677632 ATTCTATAACCCTATAAATTGGG + Intergenic
1109931072 13:69218696-69218718 CATGGACAATCCTAAAATTTGGG + Intergenic
1115736040 14:36331056-36331078 CTTACACAATCATATAAATTCGG - Intergenic
1116929555 14:50676186-50676208 CTTGGGATACCCTATCAATTGGG - Intergenic
1117787482 14:59302366-59302388 GTTGGACAACCCAATTAATGGGG + Intronic
1117938239 14:60932118-60932140 CTTGTACAAACCTATATATTAGG + Intronic
1119488180 14:75006147-75006169 CTTGGAGTAGCCTCTAAATTTGG + Intronic
1120129538 14:80788741-80788763 CTCGGTCAACCCTACAATTTAGG + Intronic
1121205349 14:92160523-92160545 CTAGTACAACCCTCAAAATTGGG + Intronic
1126551227 15:49932131-49932153 CTTGGACATGACTATAAATCAGG - Intronic
1127908385 15:63394701-63394723 CATTCACAACCCTATAAAATAGG - Intergenic
1127967879 15:63937319-63937341 ATTGGCCAATGCTATAAATTAGG + Intronic
1133147044 16:3795931-3795953 TTTGGACAACCAGAGAAATTGGG - Intronic
1134318803 16:13143895-13143917 ATTGGAAAATCTTATAAATTAGG + Intronic
1138065309 16:53934875-53934897 GTTGGTCAACCCTAAAAATCGGG - Intronic
1138743496 16:59336926-59336948 CTTTGACAATCCTATAAATAAGG - Intergenic
1143692548 17:8581688-8581710 CTTCAACAACCCTATGTATTAGG - Intronic
1148977186 17:51539675-51539697 CTTGGGCACCCCTTTAAGTTTGG - Intergenic
1149938951 17:60842320-60842342 AGTGGACAACCTTATACATTTGG + Intronic
1153900237 18:9612215-9612237 CTTGAACAACTCTATGAAGTAGG + Intronic
1154473949 18:14733499-14733521 CTTGAACAACTCTATAGAGTTGG - Intronic
1164426737 19:28148310-28148332 CTTGGACAACCCTACAGGATAGG + Intergenic
1164646789 19:29864047-29864069 CCTGGACAGCCATGTAAATTAGG - Intergenic
1165981369 19:39727088-39727110 CTGGGAAAACCCTACAAAGTAGG - Intergenic
926430015 2:12776082-12776104 CTTTGCCAATCCTATAAATTGGG - Intergenic
928555994 2:32425830-32425852 AATGCACAACCCTATATATTGGG + Intronic
934037557 2:88100962-88100984 CTTGGCTATCCCTATAATTTTGG - Intronic
935426302 2:102921677-102921699 TTACGACAACCCTATAAAGTGGG + Intergenic
939797201 2:146660084-146660106 CTTGGTCAAATCTAGAAATTAGG - Intergenic
941259415 2:163277967-163277989 CTTTAACAACCCTGTAAGTTAGG + Intergenic
944012463 2:194989614-194989636 CTTGGATAGCCCAATAAGTTGGG - Intergenic
944694032 2:202184970-202184992 CTTAGACAACCATTTAATTTTGG - Intronic
945918225 2:215727364-215727386 ATTGGCAAACACTATAAATTTGG + Intergenic
946495035 2:220187871-220187893 CTCAAACAACCCTATGAATTAGG - Intergenic
946802463 2:223434631-223434653 TTTGAGCAACCCTGTAAATTAGG + Intergenic
1170846675 20:19967893-19967915 TTATGGCAACCCTATAAATTAGG + Intronic
1173179246 20:40789984-40790006 ATTGGAAAACGCTACAAATTGGG + Intergenic
1177156628 21:17507401-17507423 ATTGGATTACACTATAAATTAGG + Intergenic
1179311979 21:40204549-40204571 CTTCCACAAACCTATAAAATAGG - Intronic
955787920 3:62559364-62559386 CTTGGAATCCCCTGTAAATTTGG - Intronic
959087895 3:101870440-101870462 CTTGCATAACCCTTTAAATTAGG - Intergenic
960431915 3:117579853-117579875 TGTGGACAACCCTATCCATTAGG - Intergenic
967235451 3:187379522-187379544 CTTGGTGAACCCTTTAAAGTAGG - Intergenic
967445157 3:189557032-189557054 CTCGGACAGCCATATAAAGTAGG + Intergenic
970674812 4:18437055-18437077 ATTGGACAAACATAAAAATTAGG + Intergenic
971073019 4:23115899-23115921 ATTGTAAAACCTTATAAATTTGG - Intergenic
972230322 4:37064969-37064991 CTCCAACAATCCTATAAATTTGG - Intergenic
972410546 4:38789260-38789282 ATTGGCAAACACTATAAATTAGG + Intergenic
973797483 4:54442946-54442968 CTGGAACAACCCTATGAAATAGG - Intergenic
974390589 4:61261601-61261623 TTTGGCCAACACTATAAATAAGG + Intronic
975879106 4:78881134-78881156 TCTGGACAACCCTATGAAGTAGG - Intronic
976197313 4:82545627-82545649 CTTAGAAAATCCTATAAACTTGG + Intronic
977874717 4:102135485-102135507 CTTGGGCAATTCTATTAATTGGG + Intergenic
979135869 4:117112712-117112734 CTTGGAAATCCATATAAATTGGG + Intergenic
979460089 4:120972216-120972238 CTTGGAAAACCCTATAAATTAGG + Intergenic
982054851 4:151538293-151538315 CTGGAACAACGCTATAAAATGGG - Intronic
986527380 5:8694780-8694802 CTTAGACTGCCCTATTAATTTGG + Intergenic
989127433 5:38070256-38070278 CTAGGATTTCCCTATAAATTGGG - Intergenic
992353984 5:75960928-75960950 CTTGAACAGCCCACTAAATTTGG - Intergenic
993141516 5:84040018-84040040 TTTACACAACCCTATAAAATAGG + Intronic
993744317 5:91577258-91577280 CATCGACAACCCTATAGAATGGG - Intergenic
995468924 5:112479759-112479781 CTTGGCCAGCCCCATAAATTTGG + Intergenic
996768386 5:127059130-127059152 GTTGGAAAGACCTATAAATTTGG + Intronic
1000132777 5:158315963-158315985 CTTGGACCAATCTATAAATTGGG - Intergenic
1001527532 5:172439436-172439458 CTCAGCCAACCCTATAAAGTAGG - Intronic
1004069576 6:12286601-12286623 CTTTGCCAAGCCAATAAATTTGG - Intergenic
1005428681 6:25730993-25731015 CTTGGACAACCATGTGAATAGGG + Intergenic
1006708186 6:36040353-36040375 CTTATATAACCCTATATATTTGG + Intronic
1009758454 6:67972607-67972629 CCTGGACAACCCCTTAAATATGG - Intergenic
1009973340 6:70647819-70647841 CTTTGACAATCTAATAAATTTGG + Intergenic
1010842050 6:80657956-80657978 ATTGGACAACCCCATCTATTAGG + Intergenic
1012431729 6:99171000-99171022 CTTGGCCATCTCTATAATTTTGG + Intergenic
1012757016 6:103244878-103244900 CTTGGAAAAGCCTATCAATTTGG - Intergenic
1015258967 6:131212541-131212563 CATTGACACCCCTATAACTTAGG - Intronic
1015542781 6:134332748-134332770 CCAGAACAACCCTATAAAGTAGG - Intergenic
1020048293 7:5061177-5061199 CTTTGACAACCCTATGATTTAGG + Intronic
1027992141 7:85376319-85376341 TTTAGATAACCCTATGAATTAGG + Intergenic
1029858734 7:103546054-103546076 GTTGGACAACACTATGAATGTGG - Intronic
1030571701 7:111234312-111234334 CCTGAACAACCCTATGAATCTGG - Intronic
1031241987 7:119257608-119257630 CTTGGACAACCTCATGTATTTGG + Intergenic
1032443174 7:131957948-131957970 CATGGAGAATCCTATAAGTTTGG + Intergenic
1034975419 7:155446438-155446460 ATTGGAAAACTCTTTAAATTTGG - Intergenic
1037074104 8:14691490-14691512 CTTTTACAATCATATAAATTAGG - Intronic
1037311794 8:17563823-17563845 CTCGGACATCCCTAAGAATTAGG - Intronic
1038419172 8:27421186-27421208 CTACAACAACCCTATAAAGTAGG - Intronic
1043344384 8:79282867-79282889 TTATGACAACCCTATAAAATAGG + Intergenic
1043986579 8:86699748-86699770 CTTGGACAACCCTATAAATTTGG - Intronic
1044933423 8:97271479-97271501 CTTGGACAACCCATTCAATCTGG - Intergenic
1045854602 8:106749449-106749471 CTTACACAACTCTATAATTTGGG - Intronic
1046946721 8:119980903-119980925 TTTGGACATCCATATAAAGTGGG + Intronic
1050919302 9:11180459-11180481 CAGGGATAACCCCATAAATTAGG - Intergenic
1051988973 9:23127642-23127664 CTTGGAGCAGCCTAGAAATTTGG + Intergenic
1052141970 9:24997257-24997279 CTTAGTCAACCCTATAAAGAAGG + Intergenic
1053525592 9:38826901-38826923 CTTGAACAACACTATAAACCAGG - Intergenic
1054197822 9:62051328-62051350 CTTGAACAACACTATAAACCAGG - Intergenic
1054640532 9:67537044-67537066 CTTGAACAACACTATAAACCAGG + Intergenic
1058507542 9:105681449-105681471 CTTGAACAAACATATAATTTGGG - Intergenic
1060862556 9:126966950-126966972 CTTGGACAACACTCTCAATCAGG - Intronic
1186552345 X:10519796-10519818 CTTGGAAAACACAACAAATTTGG + Intronic
1186956966 X:14693783-14693805 CTAGAACATCTCTATAAATTGGG + Intronic
1187629331 X:21151140-21151162 CGTGGACAACCCTTTAAATTTGG + Intergenic
1188352278 X:29146339-29146361 CTTGAAACACCCTATAAATAGGG + Intronic
1189976940 X:46470805-46470827 CTTGGAAAACCCCAAATATTTGG - Intronic
1190379652 X:49827657-49827679 CTTGGAGAACCATATATCTTTGG + Intergenic
1192451209 X:71246228-71246250 CTAGGACAACCATATGAATGAGG + Intronic
1195290201 X:103424802-103424824 GTTGTACAACTCTATACATTTGG - Intergenic
1197645490 X:129012308-129012330 CTGGGACATCCCTATGAAGTAGG - Intergenic
1198323335 X:135541648-135541670 TTAGGACAACCCTATAAAATAGG - Intronic