ID: 1043989040

View in Genome Browser
Species Human (GRCh38)
Location 8:86729967-86729989
Sequence CACTTGGTCAAATTCTTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043989037_1043989040 27 Left 1043989037 8:86729917-86729939 CCAATGGTGCTCTTTGCACATTG No data
Right 1043989040 8:86729967-86729989 CACTTGGTCAAATTCTTCCCTGG No data
1043989038_1043989040 -7 Left 1043989038 8:86729951-86729973 CCAGAGCTCATCAGTACACTTGG No data
Right 1043989040 8:86729967-86729989 CACTTGGTCAAATTCTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043989040 Original CRISPR CACTTGGTCAAATTCTTCCC TGG Intronic