ID: 1043989041

View in Genome Browser
Species Human (GRCh38)
Location 8:86729982-86730004
Sequence TTCCCTGGAATGTGTACCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043989038_1043989041 8 Left 1043989038 8:86729951-86729973 CCAGAGCTCATCAGTACACTTGG 0: 1
1: 0
2: 1
3: 10
4: 104
Right 1043989041 8:86729982-86730004 TTCCCTGGAATGTGTACCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043989041 Original CRISPR TTCCCTGGAATGTGTACCTG TGG Intronic
No off target data available for this crispr