ID: 1043989045

View in Genome Browser
Species Human (GRCh38)
Location 8:86729999-86730021
Sequence CTGTGGCAGATAGTGAAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043989038_1043989045 25 Left 1043989038 8:86729951-86729973 CCAGAGCTCATCAGTACACTTGG No data
Right 1043989045 8:86729999-86730021 CTGTGGCAGATAGTGAAATCTGG No data
1043989042_1043989045 -8 Left 1043989042 8:86729984-86730006 CCCTGGAATGTGTACCTGTGGCA No data
Right 1043989045 8:86729999-86730021 CTGTGGCAGATAGTGAAATCTGG No data
1043989043_1043989045 -9 Left 1043989043 8:86729985-86730007 CCTGGAATGTGTACCTGTGGCAG No data
Right 1043989045 8:86729999-86730021 CTGTGGCAGATAGTGAAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043989045 Original CRISPR CTGTGGCAGATAGTGAAATC TGG Intronic