ID: 1043993146

View in Genome Browser
Species Human (GRCh38)
Location 8:86780770-86780792
Sequence CCTAGCAGAGGTTCTCCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043993146_1043993151 1 Left 1043993146 8:86780770-86780792 CCTCATGGAGAACCTCTGCTAGG No data
Right 1043993151 8:86780794-86780816 CAGTGCTAAAGAGAAATGTGGGG No data
1043993146_1043993152 19 Left 1043993146 8:86780770-86780792 CCTCATGGAGAACCTCTGCTAGG No data
Right 1043993152 8:86780812-86780834 TGGGGTCAGAGCCCCCAAACTGG No data
1043993146_1043993154 21 Left 1043993146 8:86780770-86780792 CCTCATGGAGAACCTCTGCTAGG No data
Right 1043993154 8:86780814-86780836 GGGTCAGAGCCCCCAAACTGGGG No data
1043993146_1043993153 20 Left 1043993146 8:86780770-86780792 CCTCATGGAGAACCTCTGCTAGG No data
Right 1043993153 8:86780813-86780835 GGGGTCAGAGCCCCCAAACTGGG No data
1043993146_1043993149 -1 Left 1043993146 8:86780770-86780792 CCTCATGGAGAACCTCTGCTAGG No data
Right 1043993149 8:86780792-86780814 GACAGTGCTAAAGAGAAATGTGG No data
1043993146_1043993150 0 Left 1043993146 8:86780770-86780792 CCTCATGGAGAACCTCTGCTAGG No data
Right 1043993150 8:86780793-86780815 ACAGTGCTAAAGAGAAATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043993146 Original CRISPR CCTAGCAGAGGTTCTCCATG AGG (reversed) Intergenic