ID: 1043993148

View in Genome Browser
Species Human (GRCh38)
Location 8:86780782-86780804
Sequence CTTTAGCACTGTCCTAGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043993148_1043993154 9 Left 1043993148 8:86780782-86780804 CCTCTGCTAGGACAGTGCTAAAG No data
Right 1043993154 8:86780814-86780836 GGGTCAGAGCCCCCAAACTGGGG No data
1043993148_1043993159 22 Left 1043993148 8:86780782-86780804 CCTCTGCTAGGACAGTGCTAAAG No data
Right 1043993159 8:86780827-86780849 CAAACTGGGGCACTGCCTAGTGG No data
1043993148_1043993152 7 Left 1043993148 8:86780782-86780804 CCTCTGCTAGGACAGTGCTAAAG No data
Right 1043993152 8:86780812-86780834 TGGGGTCAGAGCCCCCAAACTGG No data
1043993148_1043993153 8 Left 1043993148 8:86780782-86780804 CCTCTGCTAGGACAGTGCTAAAG No data
Right 1043993153 8:86780813-86780835 GGGGTCAGAGCCCCCAAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043993148 Original CRISPR CTTTAGCACTGTCCTAGCAG AGG (reversed) Intergenic