ID: 1043993153

View in Genome Browser
Species Human (GRCh38)
Location 8:86780813-86780835
Sequence GGGGTCAGAGCCCCCAAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043993146_1043993153 20 Left 1043993146 8:86780770-86780792 CCTCATGGAGAACCTCTGCTAGG No data
Right 1043993153 8:86780813-86780835 GGGGTCAGAGCCCCCAAACTGGG No data
1043993145_1043993153 21 Left 1043993145 8:86780769-86780791 CCCTCATGGAGAACCTCTGCTAG No data
Right 1043993153 8:86780813-86780835 GGGGTCAGAGCCCCCAAACTGGG No data
1043993148_1043993153 8 Left 1043993148 8:86780782-86780804 CCTCTGCTAGGACAGTGCTAAAG No data
Right 1043993153 8:86780813-86780835 GGGGTCAGAGCCCCCAAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043993153 Original CRISPR GGGGTCAGAGCCCCCAAACT GGG Intergenic