ID: 1043993154

View in Genome Browser
Species Human (GRCh38)
Location 8:86780814-86780836
Sequence GGGTCAGAGCCCCCAAACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043993148_1043993154 9 Left 1043993148 8:86780782-86780804 CCTCTGCTAGGACAGTGCTAAAG No data
Right 1043993154 8:86780814-86780836 GGGTCAGAGCCCCCAAACTGGGG No data
1043993146_1043993154 21 Left 1043993146 8:86780770-86780792 CCTCATGGAGAACCTCTGCTAGG 0: 1044
1: 1562
2: 1412
3: 926
4: 775
Right 1043993154 8:86780814-86780836 GGGTCAGAGCCCCCAAACTGGGG No data
1043993145_1043993154 22 Left 1043993145 8:86780769-86780791 CCCTCATGGAGAACCTCTGCTAG 0: 1040
1: 1473
2: 1266
3: 802
4: 624
Right 1043993154 8:86780814-86780836 GGGTCAGAGCCCCCAAACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043993154 Original CRISPR GGGTCAGAGCCCCCAAACTG GGG Intergenic
No off target data available for this crispr