ID: 1043993159

View in Genome Browser
Species Human (GRCh38)
Location 8:86780827-86780849
Sequence CAAACTGGGGCACTGCCTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043993148_1043993159 22 Left 1043993148 8:86780782-86780804 CCTCTGCTAGGACAGTGCTAAAG No data
Right 1043993159 8:86780827-86780849 CAAACTGGGGCACTGCCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043993159 Original CRISPR CAAACTGGGGCACTGCCTAG TGG Intergenic