ID: 1043993223

View in Genome Browser
Species Human (GRCh38)
Location 8:86781235-86781257
Sequence TTATAGGCTTATATGTGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043993217_1043993223 16 Left 1043993217 8:86781196-86781218 CCCCATTGTATCTAGGAAGTAAC 0: 1114
1: 1599
2: 1420
3: 831
4: 559
Right 1043993223 8:86781235-86781257 TTATAGGCTTATATGTGGAAGGG No data
1043993218_1043993223 15 Left 1043993218 8:86781197-86781219 CCCATTGTATCTAGGAAGTAACT 0: 1072
1: 1588
2: 1299
3: 775
4: 621
Right 1043993223 8:86781235-86781257 TTATAGGCTTATATGTGGAAGGG No data
1043993219_1043993223 14 Left 1043993219 8:86781198-86781220 CCATTGTATCTAGGAAGTAACTA 0: 1208
1: 1716
2: 1488
3: 961
4: 774
Right 1043993223 8:86781235-86781257 TTATAGGCTTATATGTGGAAGGG No data
1043993214_1043993223 23 Left 1043993214 8:86781189-86781211 CCTGCACCCCCATTGTATCTAGG 0: 23
1: 685
2: 1319
3: 1644
4: 1401
Right 1043993223 8:86781235-86781257 TTATAGGCTTATATGTGGAAGGG No data
1043993213_1043993223 29 Left 1043993213 8:86781183-86781205 CCAATGCCTGCACCCCCATTGTA 0: 21
1: 571
2: 1507
3: 1833
4: 1608
Right 1043993223 8:86781235-86781257 TTATAGGCTTATATGTGGAAGGG No data
1043993216_1043993223 17 Left 1043993216 8:86781195-86781217 CCCCCATTGTATCTAGGAAGTAA 0: 922
1: 1520
2: 1486
3: 981
4: 2568
Right 1043993223 8:86781235-86781257 TTATAGGCTTATATGTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043993223 Original CRISPR TTATAGGCTTATATGTGGAA GGG Intergenic
No off target data available for this crispr