ID: 1043996063

View in Genome Browser
Species Human (GRCh38)
Location 8:86817972-86817994
Sequence ATGTGGATAAGAAGCAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043996059_1043996063 -3 Left 1043996059 8:86817952-86817974 CCATGTTATAGAATTTATCTATG No data
Right 1043996063 8:86817972-86817994 ATGTGGATAAGAAGCAGGGAAGG No data
1043996058_1043996063 0 Left 1043996058 8:86817949-86817971 CCTCCATGTTATAGAATTTATCT No data
Right 1043996063 8:86817972-86817994 ATGTGGATAAGAAGCAGGGAAGG No data
1043996057_1043996063 1 Left 1043996057 8:86817948-86817970 CCCTCCATGTTATAGAATTTATC No data
Right 1043996063 8:86817972-86817994 ATGTGGATAAGAAGCAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043996063 Original CRISPR ATGTGGATAAGAAGCAGGGA AGG Intergenic
No off target data available for this crispr