ID: 1044001715

View in Genome Browser
Species Human (GRCh38)
Location 8:86890321-86890343
Sequence TACCATATGATCTCACATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 205}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044001715 Original CRISPR TACCATATGATCTCACATAG AGG (reversed) Intronic
900877576 1:5355648-5355670 CACCATGTGTCCTCACATAGTGG - Intergenic
906549452 1:46650783-46650805 TACCACATGTTCTCACATGTTGG + Intronic
909304997 1:74062748-74062770 TACCACATGATATCACTTATGGG + Intronic
909373289 1:74912628-74912650 TACCACATGTTCTCACCTATAGG - Intergenic
909580950 1:77233768-77233790 TATTATATTATCTCACATGGTGG + Intergenic
910139739 1:84013990-84014012 TACCATATGTTCTCATAAAGTGG + Intergenic
911357040 1:96835373-96835395 TGCTATATCATCTCAAATAGTGG + Intergenic
911457124 1:98139300-98139322 TACCACATGTTCTCACTTATTGG - Intergenic
911736843 1:101345960-101345982 TACCACATGTTCTCACTTAGTGG - Intergenic
916173294 1:162018044-162018066 TACCACATGTTCTCACTTATAGG + Intronic
917172806 1:172196134-172196156 TACCATATGTTCTCACTTATCGG - Intronic
918775220 1:188620188-188620210 TTCCATGTGTTTTCACATAGTGG - Intergenic
918919969 1:190697112-190697134 TACTATATGTTCTCTCATATAGG + Intergenic
919182058 1:194098755-194098777 TACCACATGTTCTCACTTATAGG - Intergenic
921921023 1:220669687-220669709 TACCCTATGATCTCACTTACAGG + Intergenic
924734131 1:246739267-246739289 TATCATATCATATCACATCGGGG - Intronic
1064779887 10:18823643-18823665 TACCATATGTTCTCACTTAATGG - Intergenic
1065147266 10:22782337-22782359 TACTATATGATCTCACTCATAGG - Intergenic
1067879826 10:50033659-50033681 CACTATATGATTTCACTTAGAGG + Intergenic
1068661212 10:59625228-59625250 TACCGTGTGTTCTCACATATGGG + Intergenic
1068702776 10:60037520-60037542 TACCATATGTTCTCATTTAGTGG - Intronic
1069240535 10:66132811-66132833 TACCACATGTTCTCACTTATAGG + Intronic
1070627882 10:78063995-78064017 TACCAACTGACCTCACCTAGGGG - Intergenic
1071420082 10:85486503-85486525 TACCACATGCTCTCACTTATAGG - Intergenic
1072201570 10:93164183-93164205 TACCACATGTTCTCACTTATAGG - Intergenic
1072203794 10:93184192-93184214 TACCACATGTTCTCACTTATTGG - Intergenic
1072401082 10:95101098-95101120 TACTATAAGATCTCACATATAGG + Intergenic
1074845696 10:117395460-117395482 TACCATATGTACTCACATGTGGG + Intergenic
1075543445 10:123335377-123335399 TACCACATGTTCTCACTTAGTGG - Intergenic
1076108322 10:127842344-127842366 ATCAATATCATCTCACATAGAGG + Intergenic
1077780108 11:5318355-5318377 TACCACATGTTCTCACTTATAGG - Intronic
1077828116 11:5832201-5832223 TACCATGTGATCCAACATATAGG + Intronic
1078484766 11:11711514-11711536 TACCATATGTTCTCACTCATAGG - Intergenic
1081344047 11:41960666-41960688 TACCACATGTTCTCACTTATAGG + Intergenic
1082676812 11:56114999-56115021 TACCACATGTTCTCACTTACTGG + Intergenic
1083022351 11:59519966-59519988 TACCACATGTTCTCACTTATGGG + Intergenic
1085893025 11:80603527-80603549 TACCACATGATCTCATAAATAGG + Intergenic
1085965220 11:81514720-81514742 TACTGTATGATCTCACTTATAGG + Intergenic
1088225180 11:107612268-107612290 TACCAGATGTTCTCACTTATAGG + Intronic
1091964742 12:4729509-4729531 TACTACATGATCTCACTTACAGG - Intronic
1092957843 12:13566011-13566033 TTCCCTAAGATCTCAGATAGGGG - Intronic
1093415780 12:18919048-18919070 TACCACATGTTCTCACTTATAGG + Intergenic
1093452043 12:19326796-19326818 TACCGTATGTTCTCACTTACAGG - Intronic
1097696729 12:62781843-62781865 TACCAAATGATCACAAATACAGG - Intronic
1099206249 12:79730753-79730775 TACCACATGATCTCACTCAAAGG - Intergenic
1099370101 12:81818452-81818474 TACCACATGTTCTCACTTATAGG + Intergenic
1099542807 12:83934728-83934750 TAGCATATTATCTTACATAATGG + Intergenic
1099899900 12:88695195-88695217 TTCCAAATGATCTCACATCCAGG + Intergenic
1104672411 12:130689791-130689813 TACCAAATGATCACAGATGGCGG + Intronic
1105938673 13:25127508-25127530 TACCATATGTTCTCACTTGTGGG + Intergenic
1106830726 13:33579405-33579427 TACTGTATGTTCTCACATATAGG + Intergenic
1106977870 13:35243971-35243993 TAACATATGGTCTAACCTAGAGG - Intronic
1109158301 13:58939418-58939440 TACCACATGTTCTCACTTATAGG - Intergenic
1110974049 13:81807352-81807374 TACCACCTGATCTCACATGTGGG + Intergenic
1111239161 13:85451975-85451997 TACCACATGTTCTCACTTACAGG - Intergenic
1111272499 13:85904859-85904881 TACCACATGTTCTCACTTAGTGG + Intergenic
1114052479 14:18932529-18932551 TACCACATGCTCTCACTTACAGG - Intergenic
1114054519 14:18955569-18955591 TACCACATGTTCTCACTTAGGGG - Intergenic
1114108034 14:19446362-19446384 TACCACATGTTCTCACTTAGGGG + Intergenic
1114110079 14:19469396-19469418 TACCACATGCTCTCACTTACAGG + Intergenic
1114907246 14:27145321-27145343 TACCATATGTTCTCAATTATAGG - Intergenic
1115365794 14:32555674-32555696 TACTATATGATTCCACTTAGAGG - Intronic
1116120134 14:40712284-40712306 TACCGCATGCTCTCACATAAGGG + Intergenic
1117517977 14:56521450-56521472 TACCGTATGTTCTCACTTACAGG - Intronic
1118410628 14:65474058-65474080 TACCATATGTTCTCACAAGCGGG + Intronic
1121157533 14:91700739-91700761 TACCATATGTTCTCACTTGTAGG + Intronic
1121236189 14:92392784-92392806 TCCCATGTGACCTCACACAGTGG - Intronic
1121236197 14:92392833-92392855 TCCCATGTGACCTCACACAGAGG - Intronic
1121236210 14:92392931-92392953 TCCCATGTGACCTCACACAGAGG - Intronic
1121236235 14:92393078-92393100 TCCTATGTGATCTCACACAGTGG - Intronic
1124898175 15:33797019-33797041 TACCACATGTTCTCACTTAGTGG + Intronic
1126231896 15:46336961-46336983 TACCACATGTTCTCACTTATGGG + Intergenic
1126246471 15:46511980-46512002 CACCATATAATCTCACTTATAGG - Intergenic
1126349295 15:47727973-47727995 TCCCATATGATCTCAGCCAGCGG - Intronic
1126447533 15:48765531-48765553 TAAAATATGATCTCATATAATGG - Intronic
1131706895 15:95006404-95006426 TACCGTATGTTCTCACTTATAGG - Intergenic
1134363561 16:13555425-13555447 TACCAAATGTTCTCACATTTCGG - Intergenic
1137510816 16:49098569-49098591 TACCAAGTGTTCTCACTTAGAGG + Intergenic
1140185774 16:72769708-72769730 TACCATATGATCCCACATCTAGG + Intergenic
1140987170 16:80169053-80169075 TACTATATTATCCCAAATAGTGG - Intergenic
1146775406 17:35610113-35610135 TACCATATGGTGTTACTTAGGGG - Intronic
1153850136 18:9086122-9086144 TACCACATGTTCTCACAAATAGG - Intergenic
1154325117 18:13384642-13384664 TACTACATGATCTCACTTATAGG - Intronic
1155046050 18:22104155-22104177 TACCGTATGATCTCACTTGTAGG + Intergenic
1155421156 18:25657956-25657978 TGCCACGTGATCTCACATATAGG - Intergenic
1155911462 18:31508816-31508838 TACCATGTGATTTTACACAGTGG + Intronic
1156593788 18:38522286-38522308 TAACATGGGATCTCACATAATGG + Intergenic
1158794290 18:60824033-60824055 TACCACATGTTCTCACTTACTGG + Intergenic
1158816326 18:61101654-61101676 TACCACATGTTCTCACTTACAGG - Intergenic
1158816416 18:61103099-61103121 TACCACATGTTCTCACTTACGGG + Intergenic
1159324829 18:66901372-66901394 TACCATATGAGTACACAGAGTGG + Intergenic
1159343943 18:67174268-67174290 TACCATCTGACCTCACTTACAGG + Intergenic
1162836714 19:13324147-13324169 TACAGTATGATCTCACATGTGGG + Intronic
1163087018 19:14989044-14989066 TACCAAATGTTCTCACAAATGGG + Intronic
1167806667 19:51791457-51791479 TTCCATATGTCCTCACATGGTGG + Intronic
924976263 2:178684-178706 TACTATATGTTCTCACTTATAGG + Intergenic
925087838 2:1124697-1124719 TACCACATGACCTCACTTATGGG + Intronic
925715310 2:6779590-6779612 TCCTATGTGACCTCACATAGGGG + Intergenic
928425463 2:31174290-31174312 TGCCACATGTTCTCACATGGTGG - Intronic
928875748 2:36037047-36037069 TACCACATGTTCTCACTTACAGG + Intergenic
928970584 2:37024159-37024181 TACCACATGATCTCACTCATAGG + Intronic
929841570 2:45470458-45470480 CACCAAATGATCTAACAGAGAGG + Intronic
931425761 2:62169549-62169571 TACCACATGTTCTCACTTAAAGG - Intergenic
931800204 2:65750623-65750645 TACTATATGCTCTCAAATAGAGG - Intergenic
932643156 2:73471834-73471856 TACCATATGATCCCACTTCTGGG + Intronic
934162343 2:89262126-89262148 CACCAGATGTTCTCACTTAGAGG + Intergenic
934204932 2:89920227-89920249 CACCAGATGTTCTCACTTAGAGG - Intergenic
934932425 2:98437449-98437471 TACCATATAATCTATCCTAGAGG + Intergenic
935467943 2:103421505-103421527 TAACATCTGGGCTCACATAGAGG + Intergenic
936683980 2:114805857-114805879 TATCATATGACCCCACTTAGGGG + Intronic
939557671 2:143695919-143695941 TGCACTATGATCTCACATTGGGG - Intronic
942514559 2:176738155-176738177 TCTCATATGATCCCACAAAGAGG - Intergenic
943206853 2:184910202-184910224 TACCACATGTTCTCACAAATGGG - Intronic
944549750 2:200834825-200834847 TCCTATATGTTCTCACTTAGTGG + Intergenic
944900250 2:204206614-204206636 TCCCATATCATCTCAGACAGAGG + Intergenic
945761846 2:213923810-213923832 TTCCAGCTGAGCTCACATAGAGG + Intronic
1171281547 20:23903617-23903639 TACCACATGTTCTCACTTATAGG + Intergenic
1171964633 20:31520181-31520203 TACCATATGATCCACTATAGAGG + Intronic
1174667317 20:52272205-52272227 TACCACATGTTCTCACTTACAGG + Intergenic
1174966353 20:55220533-55220555 TACCACATGTTCTCACTTATAGG - Intergenic
1180470953 22:15654904-15654926 TACCACATGCTCTCACTTACAGG - Intergenic
1180472989 22:15677961-15677983 TACCACATGTTCTCACTTAGGGG - Intergenic
1182815547 22:33160056-33160078 TCCCATAAGTTTTCACATAGGGG + Intergenic
1184141488 22:42580294-42580316 TGCCGTGTGCTCTCACATAGAGG + Intergenic
949922779 3:9016035-9016057 TACAAAATAATCTCAAATAGTGG - Intronic
951980702 3:28563586-28563608 TACCATATGATTTCACACATAGG + Intergenic
952753448 3:36844523-36844545 AGCCATATGATCTCTTATAGTGG + Intronic
953122757 3:40061312-40061334 TACCACATGTTCTCACTTATAGG - Intronic
953189903 3:40675883-40675905 TACCACATGTTCTCACTTATAGG + Intergenic
954466809 3:50660084-50660106 TAGCATCTGATCTGACAGAGAGG + Intergenic
954955391 3:54514195-54514217 TACCAACTGCTCACACATAGGGG + Intronic
955928101 3:64027749-64027771 AGCCATATAATCTCACATAAAGG - Intergenic
956122030 3:65976172-65976194 TATCATCTTATGTCACATAGGGG - Intronic
956569279 3:70675895-70675917 CACCATATGATCTCACTCATAGG - Intergenic
957123300 3:76125075-76125097 TACCACATGGTCTCACTTATAGG - Intronic
957340152 3:78885171-78885193 TACCACATGTTCTCACTTATAGG + Intronic
957571854 3:81957045-81957067 TACCACATGTTCTCACTTATAGG - Intergenic
958811832 3:98868681-98868703 TACCATATGTTCTCACAAGGGGG - Intronic
962513031 3:136121345-136121367 TACCTTATGTTCTCACTTATAGG + Intronic
962674093 3:137740387-137740409 TACTACATGATCTCACTTACAGG - Intergenic
963000430 3:140676273-140676295 TACCATATGATCCCACACCTAGG + Intergenic
964080653 3:152751814-152751836 TACCACATGATCTCATTTACAGG + Intergenic
965667614 3:171111829-171111851 TACTACATGATCTCACTTATAGG + Intronic
965670684 3:171144837-171144859 TACCATATGATCTCACTCACTGG - Intronic
974790247 4:66679687-66679709 TACCACATGTTCTCACAAATGGG + Intergenic
975480714 4:74876991-74877013 TACCACATGTTCTCACTTACAGG - Intergenic
975529248 4:75384011-75384033 TACCACATGTTCTCACTTATAGG + Intergenic
977336258 4:95703382-95703404 TACCATGTGATCTCACTTATGGG - Intergenic
978995130 4:115141669-115141691 TACCACATTATCTCACTTATAGG - Intergenic
980885012 4:138752724-138752746 TACCACATGTTCTCACTTACAGG - Intergenic
981347405 4:143692299-143692321 TACCATATGGCCTCTCATATAGG + Intronic
982024175 4:151235266-151235288 TACCACATGTTCTCACTTAAAGG - Intronic
982097647 4:151937357-151937379 TACCATATGATATGACATAAAGG + Intergenic
983122089 4:163898948-163898970 TACCACATGTTCTCACTTATAGG + Intronic
983469380 4:168137509-168137531 TACCATATGTTCTCACTGATGGG - Intronic
983885930 4:172980595-172980617 AACCATATGAACACACAGAGAGG - Intronic
984433529 4:179679882-179679904 CACCATATGTTCTCACTTATAGG - Intergenic
985035474 4:185835439-185835461 AACCATATTATCTCACATTCAGG + Intronic
987513683 5:18876711-18876733 TACCATATGTTGTCACAAACAGG - Intergenic
987646946 5:20685724-20685746 TACCATGTGTTCTCACTTATAGG - Intergenic
988102287 5:26695826-26695848 TAACATATGATCTCTCCTAGAGG - Intergenic
990728031 5:58777822-58777844 CACCACATGTTCTCACTTAGAGG - Intronic
990823924 5:59875872-59875894 TACCACATGTTCTCACTTAGAGG + Intronic
992342729 5:75842452-75842474 TACCACATGATTTCACTTATAGG - Intergenic
992819019 5:80475875-80475897 TACCATATTATCCCAAATAGAGG + Intronic
994349106 5:98724127-98724149 CACCATATGTTCTCACTTATAGG + Intergenic
994386863 5:99143137-99143159 TACCATATGATCCAGCATATTGG + Intergenic
996059381 5:119015977-119015999 TACCATAGAAACTCACATACAGG - Intergenic
999838033 5:155395440-155395462 TTCCAGAAGATATCACATAGTGG + Intergenic
1001793413 5:174481342-174481364 TACCATATGATCCCACTTCTGGG + Intergenic
1003848754 6:10200666-10200688 TACCACATGTTCTCACTTATAGG + Intronic
1003906099 6:10701023-10701045 CACCACATGTTCTCACACAGGGG - Intronic
1004038498 6:11949811-11949833 CACCATGTGAGCACACATAGAGG + Intergenic
1004810425 6:19254089-19254111 TATCATATTATTTCAGATAGAGG - Intergenic
1004822778 6:19385947-19385969 TACCACATGTTCTCACTTACAGG + Intergenic
1005579469 6:27219922-27219944 TAACATATAATATCATATAGTGG - Intergenic
1005599378 6:27411179-27411201 TGCTATATGGCCTCACATAGGGG + Intergenic
1007684458 6:43656931-43656953 TTCCATATGCTTTCACAGAGAGG + Intronic
1008612844 6:53200091-53200113 TACCACATGTTCTCACTTATAGG - Intergenic
1008734633 6:54528111-54528133 TACCACATGTTCTCACTTATAGG - Intergenic
1008781940 6:55118129-55118151 TACCACATGTTCTCACTTATAGG - Intronic
1009055114 6:58325754-58325776 TGCCATAGGATTTCACAGAGGGG - Intergenic
1009236049 6:61124817-61124839 TGCCATAGGATTTCACAGAGGGG + Intergenic
1009806979 6:68612159-68612181 TTCAAAATGATCACACATAGCGG + Intergenic
1010229511 6:73522042-73522064 TTCCACATGATCTCATGTAGAGG + Intronic
1010726715 6:79343320-79343342 TACCACATGTTCTCACTTATAGG - Intergenic
1010770947 6:79830171-79830193 TAGTATATGATCTCATATAATGG + Intergenic
1012349601 6:98233964-98233986 CACCATATGTTCTCACTTATAGG - Intergenic
1012979283 6:105812792-105812814 TACCACATGTTCTCACTTATAGG + Intergenic
1014796231 6:125727953-125727975 TAGCATATGATCTCTCATATGGG + Intergenic
1014879661 6:126707873-126707895 TACTAGATGATCTCAAATTGTGG + Intergenic
1018269723 6:162064044-162064066 AACCATGGGGTCTCACATAGTGG + Intronic
1020263033 7:6541795-6541817 TACCCAATGATCTCACATGTAGG + Intronic
1023392887 7:39727502-39727524 TACCAAATGATCTCATTTATAGG - Intergenic
1024451997 7:49558167-49558189 TACCACATGCTCTCACTTACAGG + Intergenic
1025709494 7:63893827-63893849 TACCCTATGATCCCATACAGTGG + Intergenic
1029147038 7:98453830-98453852 TCCCATATGATCCCATATTGGGG + Intergenic
1030492512 7:110255377-110255399 TACCACATGTTCTCACTTACAGG - Intergenic
1030720392 7:112864157-112864179 TACCACATGTTCTCACTTATAGG + Intronic
1031795112 7:126163736-126163758 TACCATATGTTCTCACTTATAGG - Intergenic
1033892432 7:146031723-146031745 TGCCATATGATCTAACAGGGCGG + Intergenic
1037300958 8:17451444-17451466 TACCACATGTTCTCACTTACAGG - Intergenic
1037487049 8:19357512-19357534 TCCCAGAAGATCTAACATAGAGG + Intronic
1038664344 8:29524900-29524922 TACCATCTGATCTCACTTTGCGG + Intergenic
1039742013 8:40391569-40391591 TACCAAGTGATCTCACAGGGAGG - Intergenic
1041142044 8:54831273-54831295 TACCAAATGTTTTCACATAGTGG + Intergenic
1044001715 8:86890321-86890343 TACCATATGATCTCACATAGAGG - Intronic
1044214044 8:89586069-89586091 TACCACATGTTCTCACTTATAGG - Intergenic
1044413661 8:91912162-91912184 TACCATATGTTCTCACTTATAGG + Intergenic
1045613521 8:103877072-103877094 TACCATTTGATCTCACAACTGGG - Intronic
1047475406 8:125223497-125223519 TACCATATGATCCCACTTCTGGG - Intronic
1048043845 8:130755124-130755146 TACCATATGTTCTCACTTATAGG + Intergenic
1050056000 9:1655204-1655226 TACCACATGTTCTCACTTACGGG - Intergenic
1052620987 9:30910218-30910240 TACCATGTGATAACACATAGAGG - Intergenic
1056477335 9:86965423-86965445 TACAATATGATTCCACTTAGTGG - Intergenic
1057360331 9:94367385-94367407 TACCACATGTTCTCACTTATAGG - Intergenic
1057644826 9:96863773-96863795 TATCATATGTTCTCACTTATAGG + Intronic
1057663011 9:97020692-97020714 TACCACATGTTCTCACTTATAGG + Intergenic
1060046694 9:120347103-120347125 TACCGTATGTTCTCACTTACAGG - Intergenic
1185970596 X:4658258-4658280 TACCACATGTTCTCACTTATAGG - Intergenic
1185978174 X:4745470-4745492 TACCATATGTTCTCACAAGTGGG + Intergenic
1186995495 X:15117194-15117216 GACCATATGCTATCATATAGTGG - Intergenic
1187169601 X:16838402-16838424 TATTATTAGATCTCACATAGTGG + Intronic
1187480397 X:19649749-19649771 CACCATATGATTTCAGTTAGTGG + Intronic
1187568751 X:20478950-20478972 TACCATATGTTCTCACCTATAGG + Intergenic
1188380023 X:29479746-29479768 TACCATATGTTCTCACTTATAGG - Intronic
1189058065 X:37720755-37720777 TACCATATATTCTCACTTAGTGG - Intronic
1189654705 X:43231941-43231963 TGCCAAATGATTTCACAGAGTGG - Intergenic
1192738758 X:73873738-73873760 TACCATATGGTCTATCCTAGAGG - Intergenic
1193789767 X:85803172-85803194 TACCATATGTTCTCATTTATAGG - Intergenic
1194126657 X:90026663-90026685 TACCATCTGTTCTCACTTATAGG + Intergenic
1194478639 X:94392032-94392054 TACCACATGCTCTCACATGTAGG + Intergenic
1194880354 X:99243047-99243069 TGCCATATGTTCTCACTTATAGG - Intergenic
1195452956 X:105036034-105036056 TACCTCATGATCTTCCATAGAGG - Intronic
1195725394 X:107910229-107910251 TACCATATGATCTCGCACATAGG - Intronic
1196514987 X:116599689-116599711 TACCATATTATTTCTCATATAGG + Intergenic
1197023993 X:121725064-121725086 TACCACATGTTCTCACTTATAGG + Intergenic
1199301301 X:146217447-146217469 TAGACTATGTTCTCACATAGTGG - Intergenic
1199444579 X:147907317-147907339 TACCAGATGATCTTCCAAAGTGG - Intergenic
1201180873 Y:11343958-11343980 TACCTTTTGATTTCAAATAGGGG + Intergenic