ID: 1044003839

View in Genome Browser
Species Human (GRCh38)
Location 8:86917555-86917577
Sequence CAGTAGGACTGATGGGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1044003833_1044003839 9 Left 1044003833 8:86917523-86917545 CCATGAACACTGGTAAGGGTAGA 0: 1
1: 0
2: 1
3: 9
4: 117
Right 1044003839 8:86917555-86917577 CAGTAGGACTGATGGGTGGTAGG No data
1044003832_1044003839 10 Left 1044003832 8:86917522-86917544 CCCATGAACACTGGTAAGGGTAG 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1044003839 8:86917555-86917577 CAGTAGGACTGATGGGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1044003839 Original CRISPR CAGTAGGACTGATGGGTGGT AGG Intronic
No off target data available for this crispr